• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    New molecular markers for the adherent-invasive Escherichia coli (AIEC) patotype, related methods and kits. The present invention relates to novel single nucleotide polymorphisms (SNPs) useful as molecular markers to differentiate between adherent-invasive Escherichia coli (AIEC) and non-AIEC strains. It also refers to methods for using them, such as methods to detect or predict the AIEC phenotype. Furthermore, it refers to kits comprising oligonucleotides for detecting the presence of said molecular markers and their use in the methods of the invention. (Machine-translation by Google Translate, not legally binding)
    公开号:ES2724874A1
    申请号:ES201830112
    申请日:2018-02-08
    公开日:2019-09-17
    发明作者:Medina Margarita Martinez；Siles Mireia Lopez；Font Carla Camprubi
    申请人:Universitat de Girona；
    IPC主号:
    专利说明:

    [0001] COLI INVASIVE ADHERENT (AIEC), RELATED METHODS AND KITS
    [0002]
    [0003] FIELD OF THE INVENTION
    [0004] The present invention relates to the field of medicine and microbiology. Specifically, it refers to new single nucleotide polymorphisms (SNPs) useful as molecular markers to differentiate between strains of adherent-invasive Eschenchia coli (AIEC) and strains other than AIEC (non-AIEC). It also refers to methods for using them, such as methods for detecting or predicting the AIEC phenotype. In addition, it refers to kits comprising oligonucleotides for detecting the presence of said molecular markers and their use in the methods of the invention.
    [0005]
    [0006] BACKGROUND OF THE INVENTION
    [0007] Crohn's disease (CD) is a type of idiopathic chronic inflammatory bowel disease (IBD) in which the host's genetics, environmental factors and intestinal microbiome have been shown to be involved (Sartor, RB et al, 2006). It has been described that microbiome alterations, known as dysbiosis, occur in the intestine of patients with CD, in which there is a decrease in beneficial microbes and a subsequent increase in proinflammatory species (Martinez-Medina, M. et al, 2009). It has been repeatedly described that Eschenchia coli is increased in CD (Martinez-Medina, M. et al, 2009; Baumgart, M. et al, 2007; Darfeuille-Michaud, A. et al, 2004) and its abundance correlates with disease activity (Lopez-Siles, M. et al, 2014). Boudeau et al. (Boudeau et al, 1999) defined a new pathotype of this bacterial species called adherent-invasive Eschenchia coli (AIEC), and this pathotype has been associated with inflammation of the intestine in patients with CD through several independent groups (Martinez-Medina, M . et al, 2009; Darfeuille-Michaud, A. et al, 2004; Baumgart, M. et al, 2007; Martin, HM et al, 2004; Sasaki, M. et al, 2007; Eaves-Piles, T. et al, 2008; Dogan, B. et al, 2013). The AIEC patotype has the ability to adhere and invade intestinal epithelial cells and to survive and replicate within macrophages (Boudeau et al, 1999).
    [0008]
    [0009] At present, the identification of the AIEC patotype is performed by phenotypic examination of bacteria in culture, which is a technique that requires an extremely long time. In summary, AIEC strains are identified by experimentally evaluating: (i) the ability to adhere to intestinal epithelial cells; (ii) the ability to invade intestinal epithelial cells, and (iii) the ability to survive and replicate within macrophages, as described for example in Martinez-Medina, M. et al, 2009 or Darfeuille-Michaud, 2004. By Therefore, the existence of a molecular tool for the specific detection of AIECs would be of great importance to facilitate, for example, AIEC distribution studies that define which are the reservoirs of the pathotype and its transmission pathways. In addition, new personalized therapies directed against the microbiota to treat CD have been described, in particular, for the treatment of patients with CDs carrying the AIEC phenotype (Sivignon et al. 2015; Sivignon et al. 2017). The existence of a molecular marker to identify the phenotype of AIEC will be useful in the selection of those subjects that have AIEC strains in their intestinal tract (i.e., carriers of AIEC) and therefore benefit from therapies directed against AIEC.
    [0010]
    [0011] Although many of the molecular mechanisms of the pathogenicity of AIEC have been elucidated (Cieza, RJ et al, 2015; Dogan, B. et al, 2014; Gibold, L. et al, 2015; Martinez-Medina, M. and García- Gil, L., 2014; Vazeille, E. et al, 2016), there is still no gene or distinctive sequence that allows the molecular identification of AIEC strains. Some genes have been found more frequently in AIEC but these are also present in non-AIEC strains; for example, the lpfA gene has been detected in 68.4-71% of AIEC strains and in 20-28.1% of non-AIEC strains (Vazeille, E. et al, 2016; Chassaing, B et al., 2011). Likewise, fimH adhesin is ubiquitous in E. coli, and although some of its sequence variants have been found to be associated with AIEC, such variants have also been detected in non-AIEC strains (Iebba, V. et al, 2013; Dreux, N. et al, 2013; Desilets, M. et al, 2015). In addition, point mutations have been described in genes involved in the pathogenicity of AIEC, but these have been identified exclusively in strain LF82 by comparison with the commensal strain K-12. For example, it has been described that specific gene variants of ompA (Rolhion, N. et al, 2010) and chiA (Low, D. et al, 2013) confer to the strain LF82 higher rates of invasion and adhesion respectively, but it is necessary Confirmation of this finding in a wider set of strains. Finally, the differences between non-pathogenic AIEC and E. coli may include the expression of specific genes, as proposed for type 1 fimbriae (Dreux, N. et al, 2013).
    [0012]
    [0013] Several genomic studies have been carried out with the objective of characterizing the genome of AIEC strains and to identify a genetic biomarker for them. To date it is they have sequenced thirty-five strains of AIEC, most of which belong to the phylogenetic group B2 (Miquel, S. et al, 2010; Nash, JH et al, 2010; Conte, MP et al, 2014; Dogan, B. et al, 2014; Desilets, M. et al, 2015; O'Brien, CL et al, 2016). However, no gene or sequence unique to the AIEC pathotype has yet been identified. Genomic studies have confirmed that AIEC resembles ExPEC (Dogan, B. et al, 2014; Desilets, M. et al, 2015; Deshpande, NP et al, 2015). These studies have been useful in the detection of virulence genes found more frequently in AIEC strains isolated from individuals with CD in relation to AIEC strains isolated from patients without IBD. In particular, the fyuA and ibeA genes , which are involved in siderophores production and invasiveness, respectively, were found in more than 70% of AIEC strains from CD and were absent from AIEC strains isolated from individuals without IBD (Conte, MP et al, 2014). In addition, genomic studies have also shown that virulence genes such as pduC, which are involved in invasiveness and persistence, are more frequent in AIEC than in non-AIEC strains (50% and 20%, respectively) (Dogan, B. et al, 2014).
    [0014]
    [0015] The difficulties in discovering specific features of AIEC have probably been due to the fact that the first studies compared strains of AIEC and non-AIEC phylogenetically distant, and therefore, the differences found between them are related to the phylogenetic origin of the strains instead of with the AIEC phenotype (Miquel, S. et al, 2010; Nash, JH et al, 2010). Recently, Desilets, et al. (Desilets, M. et al, 2015) found, by comparing strains of AIEC and non-AIEC of the same phylogenetic group, three genomic regions present in all strains of AIEC of phylogenetic group B2 and absent from AIEC strains of other phylogenetic groups and commensal strains of any phylogenetic origin (including B2). However, it is unknown whether these regions are specific for the AIEC strains of B2 or are also present in other pathogenic groups that share the same phylogenetic origin, such as the ExPEC strains of B2. Desphande et al. (Deshpande, NP et al, 2015) described 29 single nucleotide diagnostic polymorphisms (SNPs) that produce synonymous or non-synonymous amino acid changes in a distinctive sequence ( signature sequence) that differentiates a group of pathogenic strains of B2 (consisting of 4 strains of AIEC, 3 of ExPEC, 47 strains of uropathogenic E. coli and 1 strain of avian pathogenic E. coli ) of other strains of E. coli present in the NCBI database. However, no specific feature was found that discriminates against the AIEC patotype. Finally, O'Brien et al. (O'Brien, CL et al, 2016) reduced gene content variability by performing the Genomic analysis of a set of E. coli strains of phylogenetic group B2 with an identical type sequence (ST95), thereby decreasing the possibility of detection of differential genetic elements delimited by the phylogenetic background. However, the evaluation of gene prevalence and base composition in fundamental genes did not result in the identification of a specific AIEC biomarker or even the identification of a common marker for most of the AIEC strains examined in this study.
    [0016]
    [0017] In addition, it has been described that genes that are found more frequently in AIEC are also present in other E. coli pathotypes and even in non-pathogenic E. coli (Dogan et al., 2014; Conte et al., 2014; Céspedes et al , 2017; Desilets et al, 2015, Desphande et al, 2015; Nash et al, 2010). However, differences in the expression of particular genes have been suggested according to the pathotype (Dreux, N. et al, 2013; Rolhion, N. et al, 2007).
    [0018]
    [0019] Therefore, there is still a need to develop new molecular methods to differentiate between strains with the AIEC and non-AIEC phenotype, with improved sensitivity and / or specificity. In addition, there is a need to develop a method to detect or predict the AIEC phenotype that is of general application, regardless of the phylogenetic group of the E. coli strain.
    [0020]
    [0021] SUMMARY OF THE INVENTION
    [0022] The inventors proposed that instead of differences in gene content, point mutations in core genes and / or differences in gene expression may be responsible for the AIEC phenotype.
    [0023]
    [0024] Accordingly, the inventors studied the differences in gene content and SNPs of AIEC and non-AIEC strains isolated from the human intestine. In order to find a specific AIEC biomarker, they sequenced the genomes of six strains of E. coli that consisted of three pairs of AIEC / non-AIEC strains that belonged to different phylogenetic groups (B1, B2 and D). Each pair of strains was isolated from the same patient and had an identical phylogenetic group, sequence type, virulence gene profile and pulse electrophoretic fingerprint (PFGE) (Table 1 and Table 2). The hypothesis of the inventors was that comparing pairs of genetically close strains would increase the possibility of finding specific genetic elements characteristic of the AIEC phenotype.
    [0025] In particular, no significant differences were found in the genomic structure or even in the gene content between strains of AIEC and non-AlEC, which confirms their close identity through PFGE (Figure 1). In addition, no gene was found that was present in at least two strains of AIEC and absent from all non-AIEC strains (Figure 3a). In addition, the analysis revealed no association between the presence of genes associated with AIEC previously ( lpfA154, gipA, pduC, fyuA, afaC, chuA and ibeA) (Conte, MP et al, 2014; Cieza, RJ et al, 2015; Dogan, B. et al, 2014; Vazeille, E. et al, 2016; Chassaing, B. et al, 2011; Prorok-Hamon, M. et al, 2014; Céspedes, S. et al, 2017) and the AIEC phenotype (Table 1). This result is in line with previous observations (Dogan, B. et al, 2014; O'Brien, CL et al, 2016). A similar situation was found regarding genetic variants of fimH, ompA and chiA. Although specific changes in the amino acid sequences of proteins encoded by these genes have been associated with greater adhesion / invasion capacity (Dreux, N. et al, 2013; Rolhion, N. et al, 2010; Low, D. et al, 2013), the inventors did not observe such differences between the isolates of the pairs of strains studied. Therefore, differences in the sequences of these genes would not determine the pathotype of the strains.
    [0026]
    [0027] In a further attempt to explain the phenotypic differences observed between peers, the inventors set out to identify SNPs that were differentially present in strains of AIEC and in their non-AIEC counterparts. From the total number of SNPs identified in the pairs of sequenced AIEC / non-AIEC strains, a more promising subgroup was selected (that is, it conformed to the criteria indicated in Table 5). Selected SNPs were further validated by Sanger sequencing, which resulted in the identification of a subset of twenty SNPs called "confirmed SNPs" (Tables 5 and 6).
    [0028]
    [0029] In addition, the inventors explored the usefulness of the genetic differences found as molecular markers for the identification of AIEC. In particular, they studied the variability of nucleotides within the SNPs identified in a set of AIEC and non-AIEC strains to validate or refute the hypothesis that confirmed that SNPs represent possible molecular signatures for the specific identification of the AIEC pathotype. In total, sixteen SNPs were studied in 22 strains of AIEC and 28 non-AIEC strains isolated from healthy subjects and patients with CD and that belonged to several phylogenetic groups, specifically A, B1, B2 and D (Table 7). More specifically, twelve confirmed SNPs that were not included were included. were strain specific (characteristic that was identified by in silico analysis ) , specifically those included in any of the genes E1-E2_3.6, E3-E4_4.3, E3-E4_4.4, E5-E6_3.12 and E5-E6_3 .16 = 3.22. In addition, four of the confirmed SNPs considered strain specific were included by in silico analysis (E1-E2_3.4, E1-E2_5, E1-E2_3.7 and E5-E6_3.1), which were also analyzed to confirm that they were specific of strain.
    [0030]
    [0031] The distribution of polymorphisms in the set of strains analyzed indicated that there was no particular nucleotide for any of the SNP positions that were present in all AIEC strains and that differed from the nucleotide found in that same position in non-AIEC strains. However, the inventors found SNP positions that presented differences, not only in the distribution of nucleotide variants according to the pathotype (E3-E4_4.3 (2), E3-E4_4.4 and E5-E6_3.16 = 3.22 (2 )), but also in its association with adhesion and invasion indices (E3-E4_4.3 (2), E3-E4_4.4, E5-E6_3.16 = 3.22 (2), E5-E6_3.16 = 3.22 ( 3)), see Table 8 and Figure 4.
    [0032]
    [0033] Interestingly, it was shown that two of the SNPs identified (E3-E4_4.4 and E5-E6_3.16 = 3.22 (2)) were suitable for predicting the AIEC phenotype as determined by the regression model Binary logistics (see Table 9). In particular, the SNP in E3-E4_4.4 has been shown to classify the strains as AIEC or non-AIEC with a global success of 73% and in the case of SNP E5-E6_3.16 = 3.22 (2), the overall success was similar (68.9%). In addition, the inventors have devised an AIEC strain identification algorithm that combines these two SNPs (i.e., E3-E4_4.4, E5-E6_3.16 = 3.22 (2)) and another of the confirmed non-specific strain SNPs. (ie E5-E6_3.12), which differentiates the AIEC patotype with a high accuracy rate. As shown in Figure 5, this algorithm can predict the AIEC phenotype with an accuracy of 84%.
    [0034]
    [0035] Based on these findings, the inventors propose new molecular methods to determine or predict whether an E. coli strain has a phenotype characterized by high rates of adhesion and invasion, and more specifically if it has an AIEC phenotype.
    [0036]
    [0037] Therefore, in a first aspect, the invention relates to a method for determining or predicting whether an E. coli strain has a phenotype characterized by high adhesion and invasion properties, wherein said method comprises determining the genotype of one, two, three, four or more single nucleotide polymorphisms (SNPs) selected from the group consisting of: E1-E2_3.6, E3-E4_4.3 (1), E3-E4_4.3 (2), E3-E4_4.3 (3), E3-E4_4.4, E5-E6_3.12 and of E5-E6_3.16 = 3.22 (1) to E5-E6_3.16 = 3.22 (6).
    [0038]
    [0039] In a particular embodiment, the present invention provides a method for determining or predicting whether an E. coli strain has an AIEC phenotype, wherein said method comprises:
    [0040]
    [0041] a) determine the presence or absence of the E3-E4_4.4 gene in the genome of the E. coli strain , and when present, determine the genotype at the E3-E4_4.4 polymorphic site corresponding to position 1433063 base pairs (bp) of the reference AIEC strain UM146 (NCBI NC_017632.1).
    [0042]
    [0043] In another particular embodiment, the invention relates to a method for determining or predicting whether an E. coli strain has an AIEC phenotype, wherein said method comprises:
    [0044]
    [0045] i. determine the presence or absence of the E5-E6_3.16 = 3.22 gene in the genome of the E. coli strain , and when present, determine the genotype at the E5-E6_3.16 polymorphic site = 3.22 (2) corresponding to the position 2212845 bp of the AIEC reference strain UM146 (NCBI NC_017632.1).
    [0046]
    [0047] In a related aspect, the invention relates to a method for differentiating or differentially identifying AIEC strains of non-AIEC E. coli strains, normally similar from the genetic point of view, wherein said method comprises the steps such as described according to the first aspect.
    [0048]
    [0049] In another aspect, the invention provides a method for classifying a subject as an AIEC carrier according to the presence of E. coli of the AIEC phenotype in its intestinal tract, wherein said method comprises:
    [0050]
    [0051] to. isolate strains of E. coli from an intestinal sample obtained from a subject; b. optionally, extract DNA from said E. coli strains ;
    [0052] C. determine or predict the presence of E. coli of the AIEC phenotype using a method according to a method as described herein.
    [0053] In a related aspect, the invention relates to a method for the examination of subjects carrying AIEC or the monitoring of the carrier status of AIEC in a subject, wherein said method comprises steps a) to c) as described in The previous aspect.
    [0054]
    [0055] In a further aspect, the invention relates to a method for treating a subject having an intestinal disease, wherein said method comprises:
    [0056]
    [0057] i) selecting a subject having an intestinal disease in which said subject has been classified as a carrier of AIEC by a method of classification of the invention as described hereinbefore; ii) administering to said subject a therapeutically effective amount of a treatment intended to eliminate or decrease the levels of AIEC bacteria of the intestinal mucosa as described herein.
    [0058]
    [0059] In a related aspect, the invention relates to compounds that eliminate or decrease the levels of AIEC bacteria for use in a method of treating an intestinal disease in a subject carrying AIEC, in which said subject has been identified by the use of a method of classification of the invention as described herein.
    [0060]
    [0061] A further aspect of the invention relates to a method implemented by computer as described herein.
    [0062]
    [0063] Still in a further aspect, the present invention relates to a kit for determining the genotype of the target SNPs in the genome of a strain of E. coli and its use in a method as described herein.
    [0064]
    [0065] BRIEF DESCRIPTION OF THE DRAWINGS
    [0066]
    [0067] Figure 1. Dendrogram using UPGMA consensus generated from Pearson's correlation coefficients of PFGE profiles with Xbal of the three pairs of strains selected for genome sequencing. The bar indicates the percentage similarity of the profiles.
    [0068] Figure 2. Comparison of the complete genome map of AIEC / non-AlEC strains analyzed using MAUVE 2.3. The same color boxes indicate homologous DNA segments between pairs. The boundaries between the different color blocks indicate change in the reorientation of the sequence.
    [0069]
    [0070] Figure 3. Genomic similarities between the six strains and within each pair by analysis of orthologous gene clusters (OCG). a: Edward Vennque diagram indicates the OCG number. The shaded areas correspond to clusters shared exclusively between at least two strains of AIEC. b: Percentage of OCG between pairs of phylogenetically different strains and between AIEC strains. The percentages are calculated in relation to the number of OCG variables for each strain. Those OCGs that are not present in the six strains are considered variable. Other combinations include gene clusters shared by 5 strains or 3 strains of two or three different phylogenetic groups. There were no common OCGs among AIEC strains.
    [0071]
    [0072] Figure 4. Adhesion capabilities (a) and invasion (b) of the strains according to SNP specific nucleotide variants. Only SNPs associated with significant differences (p <0.05 using the Mann-Whitney U test) in the adhesion or invasion capabilities of the variants are shown. The homogeneous subgroups (p> 0.05) within each panel are indicated by the same superscripts. The median of the data is indicated by the horizontal line in each box, the boxes cover the quantiles of 25% and 75%, and the bars show the percentiles of 10% and 90%. Atypical results are marked as points.
    [0073]
    [0074] Figure 5. Classification algorithm for the identification of AIEC. The percentages represent the proportion of strains that are correctly classified as AIEC or non-AIEC based on the result for each SNP combination. The number of total strains corresponding to each condition is indicated. (-): absence of amplification; other: a different guanine nucleotide (G) or overlapping peaks.
    [0075]
    [0076] DETAILED DESCRIPTION OF THE INVENTION
    [0077]
    [0078] Definitions
    [0079]
    [0080]
    [0081] The term "bacterial strain" as used herein refers to a genetic variant or subtype of a bacterial species. In a particular embodiment, said bacterial strain is a bacterial culture isolate.
    [0082]
    [0083] The terms "subject" or "individual" are used interchangeably herein to refer to all animals classified as mammals and include, but are not limited to, domestic and farm animals, primates and humans, for example, beings humans, nonhuman primates, cows, horses, pigs, sheep, goats, dogs, cats or rodents. Preferably, the subject is a human being male or female of any age or race.
    [0084]
    [0085] The term "polymorphism" or "allelic variant" means a common sequence variation of a gene. Allelic variants can be found in exons, untranslated regions of the gene, or in the sequences that control gene expression. Complete gene sequencing often identifies numerous allelic variants (sometimes hundreds) for a given gene. The importance of allelic variants is often unclear until further study of the genotype and corresponding phenotype is carried out in a sufficiently large population.
    [0086]
    [0087] The term "single nucleotide polymorphism" or "SNP" refers to a type of DNA polymorphism that involves the variation of a single base pair. Most often, these variations are found in gene coding sequences, non-coding regions of genes or in intergenic regions between genes. When SNPs occur within a gene or in a regulatory region near a gene, they can affect the function of the gene.
    [0088]
    [0089] The term "polynucleotide," as used herein, refers to a nucleic acid chain. Throughout this application, nucleic acids are designated from the 5'-terminal end to the 3'-terminal end. Conventional nucleic acids, for example, DNA and RNA, are usually synthesized "5 'to 3' (that is, by the addition of nucleotides at the 3'-terminal end of a growing nucleic acid).
    [0090]
    [0091] The term "oligonucleotide," as used herein includes linear or circular oligomers of natural and / or modified monomers or linkages, including deoxyribonucleosides, ribonucleosides, alpha-anomeric and substituted forms thereof, peptide nucleic acids (PNAs) , blocked nucleic acids (LNA), phosphorothioate, methylphosphonate, and the like. The oligonucleotides are capable of specifically binding to a target polynucleotide by a regular pattern of monomer interactions with monomer, such as the pairing of Watson-Crick type bases, the pairing of Ho5gsteen or inverted Ho5gsteen type bases, or the like.
    [0092]
    [0093] The term "nucleic acid based detection assay", as used herein, refers to an assay for the detection of a target sequence (for example an SNP) within a target nucleic acid and using one or more oligonucleotides. that hybridize specifically with the target sequence.
    [0094]
    [0095] The term "target sequence," as used herein, refers to the particular nucleotide sequence of a target nucleic acid to be detected. The "target sequence" includes the complexation sequences to which oligonucleotides are complexed. (eg, probe oligonucleotide, priming oligonucleotides and / or promoter oligonucleotides) during a detection procedure (for example, a detection assay based on amplification such as, for example, transcription-mediated amplification (TMA) or reaction in polymerase chain (PCR), or a non-amplification based detection assay such as, for example, a 5'-endonuclease-based assay). When the target nucleic acid is originally single stranded, the term "target sequence" will also refer to the sequence complementary to the "target sequence" as it is present in the target nucleic acid. When the target nucleic acid is originally double stranded, the term "target sequence" can refer to both sense (+) and antisense (-) chains.
    [0096]
    [0097] The term "specific" as used herein in relation to a nucleotide sequence means that a nucleotide sequence will hybridize with and / or amplify a predetermined target sequence and will not substantially hybridize with and / or amplify a non-sequence. target under test conditions, generally using astringency conditions.
    [0098]
    [0099] The term "hybridization" as used herein refers to a process whereby, under predetermined reaction conditions, two partially or completely complementary nucleic acid chains are allowed to bind antiparallel to form a nucleic acid. double stranded with hydrogen bonds stable and specific, following explicit rules in relation to which nucleic acid bases can be matched together.
    [0100]
    [0101] The term "substantial hybridization" means that the amount of hybridization observed will be such that one who observes the results will consider the positive result with respect to the hybridization data in positive and negative controls. Data that are considered "background noise" do not constitute substantial hybridization.
    [0102]
    [0103] The term "astringent hybridization conditions" means approximately 35 ° C to 65 ° C in a saline NaCl solution approximately 0.9 molar. Astringency can also be governed by reaction parameters such as the concentration and type of ionic species present in the hybridization solution, the types and concentrations of denaturing agents present, and the hybridization temperature. Generally, as hybridization conditions become more astringent, longer probes are preferred for the formation of stable hybrids. As a rule, the astringency of the conditions under which hybridization takes place will determine certain characteristics of the preferred oligonucleotides to be employed, as well as their concentration.
    [0104]
    [0105] The term "identity," as is known in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of relationship between polypeptide or polynucleotide sequences, as determined by the coincidence between chains of such sequences. The term "similarity" as used herein refers to a degree of identity of at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% of identity. "Identity" and "similarity" can be easily calculated by known methods, including, but not limited to, those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., Siam J. Applied Math., 48: 1073 (1988). In addition, values for percent identity of alignments of amino acid and nucleotide sequences generated can be obtained using the default parameters for
    [0106]
    [0107]
    [0108] AlignX component of the Vector NTI Suite 8.0 software (Informax, Frederick, Md.). Preferred methods for determining identity are designed to produce the greatest match between the sequences under test. The methods for determining identity and similarity are encoded in publicly available software. Preferred computer program methods for determining the identity and similarity between two sequences include, but are not limited to, the GCG program package (Devereux, J., et al., Acid Nucleic Research 12 (1): 387 (1984 )), BLASTP, BLASTN and FASTA (Atschul, SF et al., J. Molec. Biol. 215: 403-410 (1990). The BLAST X program is publicly available from the NCBI and other sources (BLAST Manual, Altschul, S., et al., NCBINLM NIH Betesda, Md. 20894: Altschul, S., et al., J. Mol. Biol. 215: 403-410 (1990)) The well-known Smith Waterman algorithm can also be used to determine identity.
    [0109]
    [0110] The term "aptamer" as used herein refers to oligonucleotide or peptide molecules that bind to a specific target molecule. Aptamers are usually created by selecting them from a large random sequence set, but natural aptamers may also exist in riboswitches. More specifically, aptamers can be classified as: DNA and RNA aptamers and comprise oligonucleotide chains. Peptide aptamers comprise short variable peptide domains, attached at both ends to a protein support structure.
    [0111]
    [0112] The term "treatment" encompasses both a prophylactic and therapeutic treatment. The term "therapeutic treatment" or "therapy" as used herein refers to bringing a body from a pathological state or disease back to its normal healthy state. The term "prophylactic treatment" as used herein refers to preventing a pathological state.
    [0113]
    [0114] The term "therapeutically effective amount" as used herein refers to an amount that is effective, after administration of a single dose or multiple doses to a subject (such as a human patient) in prophylactic treatment or therapeutic of a disease, disorder or pathological state.
    [0115]
    [0116] Detailed description
    [0117]
    [0118] Methods of the invention
    [0119] The first aspect of the invention relates to a method for determining or predicting whether an E. coli strain has a phenotype characterized by high adhesion and invasion capacity (such as the AIEC phenotype), in which said method comprises determining the genotype of one, two, three, four or more single nucleotide polymorphisms (SNPs) selected from the group consisting of: E1-E2_3.6, E3-E4_4.3 (1), E3-E4_4.3 (2), E3-E4_4.3 (3), E3-E4_4.4, E5-E6_3.12, and E5-E6_3.16 = 3.22 (1) to E5-E6_3.16 = 3.22 (6), in which the association of specific allelic variants of these SNPs with a highly invasive and adhesive AIEC phenotype is as described in Table 6.
    [0120]
    [0121] An E. coli strain with a high adhesion phenotype is characterized by an adhesion index (I_ADH)> 1 in intestinal epithelial cells. The I_ADH can be determined by calculating the average number of bacteria per cell, as described in example 1.
    [0122]
    [0123] A strain of E. coli with a highly invasive phenotype is characterized by an invasion index (I_INV)> 0.1% in intestinal epithelial cells, which involves the recruitment of microtubules and the actin polymerization of host cells. The I_INV can be calculated as the percentage of intracellular bacteria after 1 h of treatment with gentamicin in relation to the inoculum (i.e. I_INV (%) = (intracellular bacteria / inoculated bacteria) x 100), as described in example 1 In addition, the involvement of the cytoskeleton of the host cell can be tested by incubating monolayers of the cells with cytoskeleton inhibitors (such as cytochalasin or colchicine) and the percentage reduction of invasion rates can be determined, as described in the Example 1. Normally, there is involvement of the cell cytoskeleton when there is a reduction of at least 10%, preferably, at least 20%, at least 30%, at least 40%, at least 50%, at minus 60%, at least 70%, at least 80% or at least 90% reduction in I_INV when cells are treated with cytoskeleton inhibitors.
    [0124]
    [0125] Intestinal epithelial cells that can be used in the determination of I_ADH and / or I_INV include, but are not limited to, cell lines I-407 (ATCC® CCL-6 ™), Caco-2 (ATCC® HTB-37 ™), Hep-2 (ATCC® CCL23 ™), T84 (ATCC® CCL-248 ™) and HCT-8 (ATCC® CCL-244 ™). Preferably, for I_ADH these are selected from the group consisting of I-407 and Caco-2 and for I_INV these are selected from the group consisting of cell lines I-407 and Hep-2 (Darfeuille-Michaud et al 2004) .
    [0126]
    [0127]
    [0128] In a particular embodiment, said method comprises determining the genotypes of one, two, three and / or four SNPs selected from the group consisting of E3-E4_4.3 (2), E3-E4_4.4, E5-E6_3.16 = 3.22 (2), and E5-E6_3.16 = 3.22 (3).
    [0129]
    [0130] Preferably, said highly invasive and highly adhesive phenotype is an AIEC phenotype. Boudeau et al. (Boudeau et al., 1999) defined a new Eschenchia coli patotype called Adherent-invasive Eschenchia coli (AIEC), and this patotype has been associated with patients with Crohn's disease (CD) by several independent groups (Martínez-Medina, M . et al, 2009; Darfeuille-Michaud, A. et al, 2004; Baumgart, M. et al, 2007; Martin, HM et al, 2004; Sasaki, M. et al, 2007; Eaves-Piles, T. et al, 2008; Dogan, B. et al, 2013). The AIEC phenotype has the ability to adhere to and invade intestinal epithelial cells and survive and replicate within macrophages (Boudeau et al, 1999). AIEC constitutes an intestinal pathogenic group other than E. coli compared to previously described patotypes. Regarding their virulence genes, the AIEC pathotype resembles extraintestinal pathogenic E. coli (ExPEC), which are mostly non-invasive (Baumgart, M. et al, 2007; Miquel, S. et al , 2010; Nash, JH et al, 2010; Martinez-Medina, M. et al, 2009). Likewise, the AIEC patotype is clonally diverse, comprising all phylogenetic groups (A, B1, B2 and D), the last two having been identified as the most abundant in patients with IBD (Martinez-Medina, M. et al, 2009; Kotlowski , R. et al, 2007). Conte MP et al. (Conte, MP et al, 2014) have also described that the most prevalent phylogenetic groups in pediatric patients with CD are phylogenetic groups A and D.
    [0131]
    [0132] Strain UM146 is an AIEC strain isolated from ileal CD biopsy tissue by Krause DO et al. (Krause DO et al., 2011). Its genome has been used herein as a reference genome (NCBI NC_017632.1; https://www.ncbi.nlm.nih.gov/nuccore/NC_017632.).
    [0133]
    [0134] Current methods for characterizing the AIEC pathotype are based on the determination of the ability of the E. coli strain to adhere to and invade intestinal epithelial cells and survive and replicate within macrophages (Boudeau et al, 1999). More specifically, a bacterial strain of E. coli is phenotypically characterized as AIEC when it has a highly adhesive and highly invasive phenotype as described hereinbefore and is further characterized by presenting a replication rate> 100% in a cell line. of macrophages. For example,
    [0135]
    [0136]
    [0137] The replication rate can be calculated as the percentage of intracellular bacteria present at 24 h after infection in relation to the number of intracellular bacteria present after 1 h of treatment with gentamicin (i.e. I_REPL (%) = (CFU ml-1 at 24 h / CFU ml-1 at 1 h) x 100), as described in example 1. Macrophage cell lines that can be used in determining the replication rate include, but are not limited to, J774A.1 (ATCC® TIB-67 ™) and RAW264.7 (ATCC® TIB-71 ™) and THP-1 (ATCC® TIB-202 ™) human cell lines.
    [0138]
    [0139] In a preferred embodiment, a strain of E. coli is classified as belonging to the AIEC phenotype when it meets the following criteria, according to the definition provided by Darfeuille-Michaud et al 2004:
    [0140] (1) the ability of bacteria to invade Intestine-407 and Hep-2 epithelial cells with an invasion index equal to or greater than 0.1% of the original inoculum,
    [0141] (2) the involvement of microtubule recruitment and actin polymerization of host cells in bacterial uptake,
    [0142] (3) the absence of known invasive determinants,
    [0143] (4) the ability to adhere to differentiated and / or Intestine-407 differentiated Caco-2 intestinal epithelial cells with an adhesion index equal to or greater than 1 bacterium per cell, and
    [0144] (5) the ability to survive and replicate within macrophages J774.A1.
    [0145]
    [0146] As mentioned earlier, it was shown that genotyping of SNPs E3-E4_4.4 and E5-E6_3.16 = 3.22 (2) is useful for differentiating between AIEC and non-AlEC phenotypes (see Table 9 and Figure 5).
    [0147]
    [0148] Accordingly, the invention also relates to a method for determining or predicting whether an E. coli strain has an AIEC phenotype (in other words, a method for detecting or predicting the AIEC phenotype), in which said method comprises:
    [0149]
    [0150] a) determine the presence or absence of the E3-E4_4.4 gene in the genome of the E. coli strain , and when present, determine the genotype at the E3-E4_4.4 polymorphic site corresponding to position 1433063 bp of the AIEC reference strain UM146 (NCBI NC_017632.1).
    [0151]
    [0152]
    [0153] In a particular embodiment, the presence of a G nucleotide at the polymorphic site of a) is indicative of a non-AIEC phenotype. As shown in Figure 5, the presence of a G nucleotide at the E3-E4_4.4 polymorphic site results in 85.7% of correctly predicted non-AIEC strains.
    [0154]
    [0155] In another embodiment, said method comprises:
    [0156]
    [0157] a) determine the presence or absence of the E3-E4_4.4 gene in the genome of the E. coli strain , and when present, determine the genotype at the E3-E4_4.4 polymorphic site corresponding to position 1433063 bp of the AIEC reference strain UM146 (NCBI NC_017632.1); Y
    [0158]
    [0159] b) determine the presence or absence of the E5-E6_3.16 = 3.22 gene in the genome of the E. coli strain, and when present determine the genotype at the E5-E6_3.16 polymorphic site = 3.22 (2) corresponding to position 2212845 bp of the reference AIEC strain UM146 (NCBI NC_017632.1);
    [0160]
    [0161] wherein the absence of the E3-E4_4.4 gene in a), and the presence of a G nucleotide at the polymorphic site of b) are indicative of an AIEC phenotype, and / or
    [0162] wherein the absence of the E3-E4_4.4 gene in a) and the absence of the E5-E6_3.16 gene = 3.22 or the presence of a non-G nucleotide at the polymorphic site of b) are indicative of non-AIEC phenotype ; I
    [0163] wherein the presence of a nucleotide other than G at the polymorphic site of a), and the absence of the E5-E6_3.16 = 3.22 gene or the presence of G at the polymorphic site of b) are indicative of the AIEC phenotype.
    [0164]
    [0165] The expression "a nucleotide other than G" as used herein may refer to those cases in which the presence of another nucleotide is determined or it was not possible to establish a specific nucleotide for this position (for example, a peak is found overlap in this position when performing a Sanger sequencing).
    [0166]
    [0167] In a further embodiment, said method comprises:
    [0168]
    [0169] a) determine the presence or absence of the E3-E4_4.4 gene in the genome of the E. coli strain , and when present, determine the genotype at the polymorphic site
    [0170]
    [0171]
    [0172] E3-E4_4.4 corresponding to position 1433063 bp of the reference AIEC strain UM146 (NCBI NC_017632.1);
    [0173]
    [0174] b) determine the presence or absence of the E5-E6_3.16 = 3.22 gene in the genome of the E. coli strain , and when present determine the genotype at the E5-E6_3.16 polymorphic site = 3.22 (2) corresponding to position 2212845 bp of the reference AIEC strain UM146 (NCBI NC_017632.1); Y
    [0175]
    [0176] c) determine the presence or absence of the E5-E6_3.12 gene in the genome of the E. coli strain , and when present determine the genotype at the E5-E6_3.12 polymorphic site corresponding to position 4271710 bp of the strain Reference AIEC UM146 (NCBI NC_017632.1);
    [0177]
    [0178] wherein the presence of a nucleotide other than G at the polymorphic site of a), the presence of a nucleotide other than G at the polymorphic site of b) and the presence of G at the polymorphic site of c) are indicative of a AIEC phenotype, and / or
    [0179] wherein the presence of a nucleotide other than G at the polymorphic site of a), the presence of a nucleotide other than G at the polymorphic site of b) and the presence of A at the polymorphic site of c) are indicative of a non-AIEC phenotype.
    [0180]
    [0181] The method according to any of the above embodiments may further comprise determining the genotype of one, two, three or more of the SNPs selected from the group consisting of: E1-E2_3.6, E3-E4_4.3 (1), E3-E4_4 .3 (2), E3-E4_4.3 (3), E5-E6_3.16 = 3.22 (1), E6_3.16 = 3.22 (3), E6_3.16 = 3.22 (4), E6_3.16 = 3.22 ( 5) and E5-E6_3.16 = 3.22 (6), as described herein.
    [0182]
    [0183] In still a further embodiment, the invention relates to a method for determining or predicting whether an E. coli strain has an AIEC phenotype, wherein said method comprises:
    [0184]
    [0185] i. determine the presence or absence of the E5-E6_3.16 = 3.22 gene in the genome of the E. coli strain, and when present determine the genotype at the polymorphic site E5-E6_3.16 = 3.22 (2) corresponding to the position 2212845 bp of the AIEC strain of reference UM146 (NCBI NC_017632.1);
    [0186]
    [0187]
    [0188] wherein the presence of a G nucleotide at the polymorphic site of b) is indicative of an AIEC phenotype.
    [0189]
    [0190] The method according to the previous embodiment may further comprise determining the genotype of one, two, three or more SNPs selected from the group consisting of: E1-E2_3.6, E3-E4_4.3 (1), E3-E4_4.3 ( 2), E3-E4_4.3 (3), E3-E4_4.4, E5-E6_3.12, E5-E6_3.16 = 3.22 (1), E5-E6_3.16 = 3.22 (3), E5-E6_3. 16 = 3.22 (4), E5-E6_3.16 = 3.22 (5) and E5-E6_3.16 = 3.22 (6), as described herein.
    [0191]
    [0192] One skilled in the art will understand that it may also be possible to determine the above-mentioned SNPs at the protein level when nucleotide substitution is not synonymous and results in an amino acid change. These have been specified in Table 10 below for confirmed non-strain SNPs as described herein.
    [0193]
    [0194]
    [0195] Table 10. Nucleotide variants in confirmed non-strain SNPs that correspond to amino acid changes.
    [0196]
    [0197] Variant of
    [0198] Nucleotide variant
    [0199] ID Change of nucleotide amino acid * 1 detected by
    [0200] Sanger * 1
    [0201]
    [0202] E1-E2_3.6 C / TC / T Alanine / Threonine
    [0203] E3-E4_4.3 (1) C / TC / Y Asparagine / Aspartate
    [0204]
    [0205] E3-E4_4.3 (2) C / TY / Y Serine / Glycine
    [0206]
    [0207] E3-E4_4.3 (3) T / GT / K Glutamate / Lysine
    [0208]
    [0209] E3-E4_4.4 A / GR / R Glutamate / Glycine
    [0210]
    [0211] E5-E6 3.12 A / GA / G Threonine / Alanine
    [0212] E5-E6_3.16 = 3.22 (1) T / CY / Y Histidine / Alanine
    [0213]
    [0214] E5-E6_3.16 = 3.22 (2) C / GS / S Arginine / Proline
    [0215]
    [0216] E5-E6_3.16 = 3.22 (3) G / AR / R Arginine / Cysteine
    [0217] C / A M / M
    [0218] E5-E6_3.16 = 3.22 (4) Leucine / Phenylalanine
    [0219] C / T Y / Y
    [0220] E5-E6_3.16 = 3.22 (5) Cysteine / Tyrosine
    [0221] C / G S / S
    [0222] E5-E6_3.16 = 3.22 (6) Valine / Leucine
    [0223] * 'A: adenine; C: cytosine; G: guanine; K: guanine or thymine; M: adenine or cytosine; R: adenine or guanine; S: guanine or cytosine; T: thymine; W: adenine or thymine; Y: cytosine or thymine.
    [0224]
    [0225] For example, for SNP E3-E4_4.4 in which the change of nucleotide A / G has been described herein which results in a change of amino acid E (Glu) / G (Gly); for SNP E5-E6_3.16 = 3.22 (2) in which the C / G nucleotide change has been described herein that results in an amino acid change R (Arg) / P (Pro); and SNP E5-E6_3.12 in which the change of nucleotide A / G has been described herein which results in a change of amino acid T (Thr) / A (Ala).
    [0226]
    [0227] The proteins encoded by each of the 5 genes comprising non-strain specific SNPs as described herein are provided in Table 11 below.
    [0228] Table 11. Proteins corresponding to E. coli genes comprising confirmed non-strain specific SNPs.
    [0229]
    [0230]
    [0231]
    [0232]
    [0233] Methods for specifically detecting and / or quantifying proteins are well known in the art. Traditionally, the detection and / or quantification of proteins in solution have been carried out by immunoassays on a solid support. Such immunoassays can be for example an enzyme-linked immunosorbent assay (ELISA), a fluorescent immunoabsorption assay (FIA), a chemiluminescence immunoassay (CIA) or a radioimmunoassay (RIA), a homogeneous enzyme immunoassay, a solid phase solid immunoassay (SPROA), a fluorescent polarization (FP) test, a fluorescence resonance energy transfer (FRET) test, a time resolution fluorescence resonance energy transfer (TR-FRET) test, an assay of surface plasmon resonance (SPR). Specifically, the multiplex and new generation versions of any of the foregoing are included, such as beadbased flow-cytometry (for example, based on Luminex xMAP technology).
    [0234]
    [0235] Other methods that can be used for protein quantification are techniques based on mass spectrometry (MS) such as liquid chromatography coupled to mass spectrometry (LC / MS), described for example in US2010 / 0173786, or CL-MS / Tandem MS (documents WO2012 / 155019, US2011 / 0039287, M. Rauh, J Chromatogr B Analyt Technol Biomed Life Sci, February 1, 2012, 883-884, 59-67) and the use of peptide, protein alignments or antibodies and multiplex versions of the prior techniques, as well as the next generation of such techniques and combinations thereof.
    [0236]
    [0237] The chronological order of stages in the methods as described herein is not particularly limited. These can occur in the order indicated, or in any order, or simultaneously. In a particular embodiment, the determination of the genotype in the SNPs according to the methods of the invention can be used to obtain a score according to a given mathematical algorithm, in which the genotype in each of the SNPs used in the methods of the invention are the variables of said mathematical algorithm.
    [0238]
    [0239] It is not claimed that a method of the invention, as understood by one skilled in the art, is correct in 100% of the samples analyzed. However, it requires that a statistically significant amount of the analyzed samples be correctly classified. The amount that is statistically significant can be established by one skilled in the art through the use of different statistical tools; Illustrative, non-limiting examples of such statistical tools include determining confidence intervals, determining the p-value, discrimination functions of the Chi-square test, etc. Preferred confidence intervals are at least 90%, at least 95%, at least 97%, at least 98%, at least 99%. P values are preferably less than 0.1, less than 0.05, less than 0.01, less than 0.005 or less than 0.001. The teachings of the present invention preferably allow the correct phenotype to be determined or predicted correctly by at least 60%, at least 70%, at least 80%, at least 90% or at least 95% of the group or population analyzed.
    [0240]
    [0241] Sensitivity, specificity and / or accuracy are parameters normally used to describe the validity or performance of a test. In particular, they are used to quantify how good and reliable the discrimination method is. A test is usually calibrated in terms of the specificity and sensitivity desired according to the specific use of the test in clinical practice. High sensitivity corresponds to a high negative predictive value and is an ideal property for an "exclusion" test. High specificity corresponds to a high positive predictive value and is an ideal property for an "inclusion" test.
    [0242]
    [0243]
    [0244] In preferred embodiments, the methods of the invention have sensitivity, specificity and / or accuracy values of at least about 60%, preferably at least about 70%, and may be, for example, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100 % in at least 60% of the group or population tested, or preferably in at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of the group or population tested.
    [0245]
    [0246] The determination of the genotype in the SNP, which as used herein includes determining the presence or absence of the gene containing the single nucleotide polymorphism (SNP) and / or the allelic variant at each SNP position according to the methods of the invention, it can be performed by any of the methods known in the art, which include, but are not limited to, DNA sequencing, a nucleic acid based detection assay or any other genotyping method known in the art. . Actually, there are numerous strategies for genotype analysis. Example methods include, but are not limited to, direct sequencing, restriction fragment length polymorphism (RFLP) analysis; Hybridization with allele-specific oligonucleotides (ASOs) which are short synthetic probes that hybridize only with a perfectly matched sequence under suitable hybridization astringency conditions; Allele-specific PCR; PCR and sequencing, PCR using mutagenic primers; ligase-PCR, excision by HOT; Gel electrophoresis with gradient denaturation (DGGE), gel electrophoresis with temperature denaturation gradient (TGGE), single chain conformational polymorphism (SSCP), high performance liquid chromatography with denaturation (Kuklin et al, 1997), microalignment of DNA, metagenomics and aptamer recognition. Direct sequencing can be carried out by any method, including without limitation chemical sequencing, using the Maxam-Gilbert method; by enzymatic sequencing, using the Sanger method; mass spectrometry sequencing; pyrosequencing, sequencing using a DNA microalignment and quantitative PCR.
    [0247]
    [0248] The term oligonucleotides specific for the target sequence may refer to a primer, a probe, a pair of primers, a pair of primers and a probe, or a primer and a probe. A person skilled in the art will know the most appropriate oligonucleotides or the combination thereof according to the molecular method used for the purposes of genotyping By way of example, for amplification purposes, two primers are generally used, while for sequencing purposes a single primer is often used.
    [0249]
    [0250] In some embodiments, the determination is made by a nucleic acid based detection assay. In a particular embodiment, said nucleic acid based detection assay is an amplification based assay. An amplification-based assay of this type comprises an amplification step comprising contacting a sample (preferably an isolated DNA sample) with two or more amplification oligonucleotides specific for a target sequence in a target nucleic acid to produce an amplified product. if the target nucleic acid sequence is present in the sample. Suitable amplification methods include, for example, replicase mediated amplification, ligase chain reaction (LCR), chain shift amplification (SDA), transcription mediated amplification (TMA) and polymerase chain reaction (PCR), which includes quantitative PCR.
    [0251]
    [0252] For example, genotyping of SNPs according to the methods of the invention can be detected in a DNA sample, preferably after amplification. For example, isolated DNA can be amplified by PCR, using specific oligonucleotide primers that are specific for the polymorphism or that allow amplification of a region containing the polymorphism. In a first example, the conditions for primer pairing can be chosen to ensure specific amplification; so that the appearance of an amplification product will be indicative of the presence of the target sequence (for example the allelic target form in the SNP). Alternatively, the DNA can be amplified, after which the target sequence in the amplified sequence can be detected by hybridization with a suitable probe or by direct sequencing, or any other appropriate method known in the art. Preferably, genotype determination is performed by allele-specific PCR.
    [0253]
    [0254] These oligonucleotides can be ribonucleotides or deoxyribonucleotides. In particular embodiments, the oligonucleotides may have at least one chemical modification. For example, suitable oligonucleotides may be composed of one or more bicyclic sugar nucleoside modifications or "conformationally restricted", for example, "blocked nucleic acids". "Blocked nucleic acids" (LNAs) are modified ribonucleotides that contain an extra bridge between 2 ’and 4’ carbons.
    [0255]
    [0256]
    [0257] Ribose sugar moiety resulting in a "blocked" conformation that confers enhanced thermal stability to the oligonucleotides containing the LNAs. In other embodiments, the oligonucleotides may comprise peptide nucleic acids (PNAs), which contain a peptide-based main structure in instead of a main sugar-phosphate structure Other chemical modifications that oligonucleotides may contain include, but are not limited to, sugar modifications, such as 2'-O-alkyl modifications (for example 2'-O-methyl, 2'-O-methoxyethyl), 2'-fluoro and 4'-thio, and modifications of the main structure, such as one or more phosphorothioate, morpholino or phosphonocarboxylate junctions, for example, these oligonucleotides, particularly those of shorter lengths (for example, less than 15 nucleotides) may comprise one or more affinity enhancement modifications, such as, but not limited to, LN A, bicyclic nucleosides, phosphonoformates, 2 ′ O-alkyl and the like. In some embodiments, the oligonucleotides can be modified clinically, for example to improve their resistance to degradation by nucleases (for example, by occupation of ends), to carry detection ligands (for example, fluorescein) or to facilitate their capture on a support. solid (for example, "tails" of poly-deoxyadenosine).
    [0258]
    [0259] Preferable oligonucleotides useful in the methods of the invention are about 5 to about 50 nucleotides in length, about 10 to about 30 nucleotides in length, or about 20 to about 25 nucleotides in length. In certain embodiments, oligonucleotides that specifically hybridize with the target sequence are about 19 to about 21 nucleotides in length. These oligonucleotides may comprise in some embodiments a sequence that is at least partially complementary to the target nucleic acid sequence comprising the target allelic form of the SNP, for example complementary to at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% to the target nucleic acid sequence.
    [0260]
    [0261] In the present invention, the target nucleic acid sequence refers to the region of the nucleic acid sequence of the AIEC reference genome (ie, of the reference AIEC strain UM146) comprising the target allelic form of the SNP. The target nucleic acid sequence may include, for example, from 5 to 600 nucleotides in the 5 'and / or 3' direction of the target SNP, preferably from 10 to 400 nucleotides in the 5 'and / or sense the 3 'direction of the target SNP, more preferably from 20
    [0262]
    [0263]
    [0264] up to 200 nucleotides in the 5 'and / or 3' direction of the target SNP, such as at least 20, 30, 40, 50, 60, 70, 80, 90, 100 or at least 150 nucleotides in the 5 'direction and / or 3' direction of the target SNP. For illustrative purposes, example target sequences are shown for polymorphic sites E3-E4_4.4, E5-E6_3.16 = 3.22 (2) and E5-E6_3.12 below in the present document.
    [0265]
    [0266] SEQ ID NO: 27 comprising SNP E3-E4_4.4 (highlighted in bold and underlined), corresponding to CP002167.1: 1433652-1432471 of the complete Eschenchia coli UM146 genome:
    [0267]
    [0268] ATGCACGAAAAGAACATCGCCCTGCTTTGTGATGAAGCCGACCGACTTTTGCAACTGAACATTAA TCTGCTCCGGCAAATGGTTGAGGAGCCAGATGTGTTATCTGACAGTAAGAACGAAAACAGACTG CTTTTTGATAAACAGAAAGCACTGAAAAGAATTGAGGAGCTGGAGGGCGAACAAATCAAAACCGC CCGCAGGGAGATGGTGCTGGCTGTTGTCGGCACGATGAAAGCAGGCAAATCAACCACCATCAA CGCCATTGTGGGGCAGGAAATTCTGCCTAACCGTAACCGCCCCATGACCTCTGTACCGACGCTC ATCCGCCACGTTCCCGGAAAAACTGAGCCGGTTCTCCATCTGGAACATATTCAGCCTGTCCGCA ATTTATTAATCACACTGCAGGAAAAACTCGCCACCCCGGCAGGACAGCAGGTCGCACAGACCCT GCAGCAAACCGGGGATACCCGCGAACTGCTGGATATTCTGACGGATGATGGCTGGCTCAAAAAT GAATACCACGGGGAGGAGGAAATCTTTACCGGACTGGCATCGTTAAACGATCTGGTTCGTCTTG CTGCGGCAATGG G GACTGAATTTCCTTTTGATGAATACGCAGAAGTGCAGAAACTGCCGGTGAT CGACGTGGAATTCAGCCATCTGGTGGGGATGGATGCATGCCAGGGAACACTCACACTGCTGGAT ACCCCCGGCCCTAATGAGGCCGGACAACCGCAGATGGAAGTGATGATGCGGGATCAACTGCAG AAAGCCTCTGCGGTTCTGGCTGTGATGGATTACACCCAGATGAACTCAAAAGCGGATGAAGACG TCCGTAAAGAGCTTAATGCCATTGCTGACGTATCAACCGGCCGCCTGTTTGTACTGGTCAATAAA TTTGATGAGAAAGACCGCAATGGCGATGGGGCAGATGCCGTACGCCAGAAAGTTCCGGCAATG CTGAACAGCGATGTGCTGCCCGC CTCCCGCGTTTATCCCGGATCCTCACGCCAGGCATACCTGG CTAACCGTGCGCTTCATGAGTTACGGAAAAACGGAACCCTTCCTGTTGATGAAGCCTGGGTCGA TGATTTTGTCAGGGAAGCCTTCGGTCGCATGAAAAGATTACGAGGGGGGGGGG
    [0269]
    [0270] SEQ ID NO: 28 comprising SNP E5-E6_3.16 = 3.22 (2) (highlighted in bold and underlined), corresponding to CP002167.1: 2212514-2212960 of the complete Eschenchia coli UM146 genome:
    [0271]
    [0272] ATCACTTCCGGTCAGCACATCGTGCGTTTTCCCCTTGTTGTCAGTTACGCGGAGATAATCCCCGG AGAAAGTCGACACACGGCTGTAAGCCACACCCGCCATCGAATACGCGCTGAACCATTCATTCAC GCGTACAGACGGCCCCGCCATCACGCTGAACCAGCGGTTACGCACGGAATCTTCATGCCAGCG GGTATCGCTGTAGTGCGTTTTTTGCTCATCCTCAGCATTGGCATAACTGAAGGACGTAATCAGCC CCAGCGCGTCCGTAAACTCATAACGGTATTTCACGTTAATCCCGTTCAGATTATCGCTGCCGGGA GCGTTCGTA C GGGCATGAAGATACCCCGCGCTCAGTGTGGACTGATGTTCAGACGCCCATGCA GGCGCACCGGATACGGACAGACAGATGGCTGCGGACAAAATGACTGCACAAACTTTACGCAT
    [0273]
    [0274]
    [0275] SEQ ID NO: 29 comprising SNP E5-E6_3.12 (highlighted in bold and underlined), corresponding to CP002167.1: 4271302-4271808 of the complete genome of Eschenchia coli UM146:
    [0276]
    [0277] AAAGGCGCGGTACTTAAAGCGCAGGTACATGCTGGTGGGCGCGGTAAAGCTGGCGGCGTAAAA GTGCTTAAGCAGCTGCCGGAAGCACAGGCTTTTGTACAGCAAATGTTGGGATCGCAACTGGTGA CTTATCAGACCGGGCCAGAAGGGCAGTATGTCAGCAGTATTTTGCTGTGCGAAAACATCTATCC GGTACGCCAGGAACTCTATTTTGGCATGGTGGTGGATCGTGAAAGCCAGCGGGTCACGTTTATT GTCAGCCCGGAAGGTGGCGTGGAAATTGAAAAAGTCGCCCATGAGACACCGGAGAAAATCAGC AGTGTCAGCATTGATCCACTGACAGGCGTGCAGCCTTGCCATATCCGCGAAATGTTTGCTGTTCT GCAACTGGAACACGGGCTATTTGCT A CCTTTAGTCGCCTGGTTAATCAGGCGTGGAAAGCCTTTA ACGAACTGGATTTCGCCCTGCTGGAAATTAACCCTCTGGTGTTGCGGGAAACGGGCGAA
    [0278]
    [0279] In preferred embodiments, the oligonucleotide may be substantially complementary to the target nucleic acid sequence, which is complementary in at least about 95%, 96%, 97%, 98% or 99% to a target polynucleotide sequence. . In those embodiments in which the oligonucleotides are partially or substantially complementary, it is perfectly complementary to the target SNP and preferably, complementary in 97%, 98% or 99% for 1, 2, 3, 4 or 5 nucleotides in 5 'and / or 3' direction with respect to the target SNP. In one embodiment, the oligonucleotide comprises a sequence that is 100% complementary to the target nucleic acid sequence comprising the target allelic form of the SNP.
    [0280]
    [0281] Oligonucleotides that specifically hybridize with the target sequence (eg, priming and / or probe oligonucleotides) may comprise a sequence selected from the group consisting of the oligonucleotide sequences disclosed in Table 13 or a sequence with an identity of at least about 90%, preferably at least about 95%, 96%, 97%, 98% or 99%.
    [0282]
    [0283] In a particular embodiment, optionally in combination with one or more of the features or embodiments described above or below, the method according to the invention is useful for the determination of the target phenotype (for example the AIEC phenotype) in an E. coli strain . of any phylogenetic group, preferably of the phylogenetic groups A, D, B2 or B1. In fact, Table 9 shows that the absence of G at the polymorphic site E3-E4_4.4 and the presence of G at the site E5-E6_3.16 = 3.22 (2) have demonstrated
    [0284]
    [0285]
    [0286] be predictive of the AIEC phenotype within a set of strains of phylogenetic groups A, D, B2 or B1 (see Table 7).
    [0287]
    [0288] The E. coli strain whose phenotype is determined according to a method of the invention can be obtained from a biological sample of a subject.
    [0289]
    [0290] The term "sample" or "biological sample", as used herein, refers to biological material isolated from a subject. The biological sample may contain any biological material suitable for detecting the target sequence and may comprise cellular and / or non-cellular material of the subject. The sample can be isolated from any suitable biological tissue or fluid such as, for example, blood, blood plasma, serum, cerebrospinal fluid (CSF), urine, amniotic fluid, lymphatic fluids, external secretions of the respiratory, digestive, genitourinary, tears , saliva, white blood cells. In some embodiments, the samples used for the detection of the target sequence in the methods of the invention are samples that can be obtained using minimally invasive procedures. In a preferred embodiment, the samples are intestinal samples. These may be for example a biopsy of the mucous tissue of the intestinal tract, such as the ileum, colon and / or rectum. Preferably, this intestinal sample is a stool sample.
    [0291]
    [0292] These types of samples are used routinely in clinical practice and a person skilled in the art will know how to identify the most appropriate means for obtaining and preserving them. Once a sample has been obtained, it can be used freshly prepared, it can be frozen, lyophilized or preserved using appropriate means. Preferably, said sample is a freshly prepared sample.
    [0293]
    [0294] Normally, the molecular determination or prediction of the AIEC phenotype according to a method of the invention is carried out in cells of an isolated strain of E. coli. Methods for isolating E. coli strains are well known in the art . These methods will generally comprise a first stage of selection by culture in selective media (such as TBX agar or MacConkey agar) followed by a biochemical confirmation test, such as the indole test or biotyping systems such as the Analytab Enteric system (API 20E ) or the Vitek automated system (BioMérieux, Marcy l'Etoile, France). In a preferred embodiment, the E. coli strain is isolated by selective culture on TBX agar followed by indole and / or Vitek assays.
    [0295]
    [0296]
    [0297] (see for example, Martínez-Medina et al. 2009). Subsequently, target regions of the E. coli genome can be amplified and / or sequenced for genotyping of the target SNPs according to the methods of the invention.
    [0298]
    [0299] In some embodiments, the methods of the invention may comprise a step of DNA extraction prior to the determination of the genotype of the target SNPs. In a particular embodiment, bacterial cells are lysed and extracts are obtained with chloroform / methanol. For example, genomic DNA can be extracted from bacterial cells using the Wizard® genomic DNA purification kit (Promega) according to the manufacturer's instructions; and preferably the samples are treated with RNase A. In other embodiments, genotype determination can be carried out on the material obtained in addition to the lysis of the bacterial cells (for example, by heating up to 95 ° C for 3 minutes). For example, PCR amplification with specific oligonucleotides is performed on the cell lysis product followed by sequencing of the PCR products for the determination of allelic form in the target SNP.
    [0300]
    [0301] In a related aspect, the invention relates to a method for differentiating or differentially identifying AIEC strains of non-AlEC strains, normally similar from the genetic point of view, in which said method comprises the steps as described. earlier in this document according to the first aspect. For example, said method will molecularly distinguish an E. coli strain with an AIEC phenotype from an E. coli strain with an ExPEC phenotype. The AIEC patotype resembles ExPEC in its virulence genes, but these pathovars differ phenotypically in that ExPEC is primarily non-invasive (Baumgart, M. et al, 2007; Miquel, S. et al, 2010; Nash, JH et al , 2010; Martínez-Medina, M. et al, 2009). It has been described that ExPEC strains belong to different phylogenetic groups. For illustration purposes, ExPEC strains include, but are not limited to, the following: UMNK88 (NCBI registration number CP002729.1) of phylogenetic group A, 55989 (NCBI registration number CU928145.2) of the phylogenetic group B1, S88 (NCBI registration number CU928163.2) of phylogenetic group B2, 042 (NCBI registration number NC_017626.1) of phylogenetic group D and EDL933 (NCBI registration number AE005174.2) of phylogenetic group E.
    [0302]
    [0303] In another aspect, the invention provides a method for classifying a subject as an AIEC carrier according to the presence of E. coli of the AIEC phenotype in its intestinal tract, wherein said method comprises:
    [0304] to. isolate strains of E. coli from an intestinal sample obtained from a subject;
    [0305] b. optionally, extract DNA from said E. coli strains ;
    [0306] C. determine or predict the presence of E. coli of the AIEC phenotype using a method according to a method as described herein.
    [0307]
    [0308] In a related aspect, the invention relates to a method for the examination of subjects carrying AIEC or the monitoring of the carrier status of AIEC in a subject, wherein said method comprises steps a) to c) as described in The previous aspect.
    [0309]
    [0310] In some embodiments, it may be desirable to identify a subset of AIEC carrying subjects that have AIEC levels above a given threshold. This may involve determining the abundance of each of the target SNPs in a population of E. coli isolated from said subject.
    [0311]
    [0312] In a particular embodiment, said subject has an intestinal disease. In a preferred embodiment, said disease is inflammatory bowel disease.
    [0313]
    [0314] The term "inflammatory bowel disease" (IBD) as used herein refers to a group of idiopathic chronic inflammatory bowel states. The two main disease categories covered by the term are CD and ulcerative colitis (UC), both with overlapping and differentiated clinical and pathological characteristics. The diagnosis of IBD requires a complete physical examination and a review of the patient's history. Various tests, including blood tests, stool exams, endoscopy, biopsies and imaging studies help exclude other causes and confirm the diagnosis. (World Gastroenterology Organization Global Guidelines, Inflammatory bowel disease: a global perspective, June 2009; and Silverberg et al., Can J Gastroenterol. 2005, 19 Suppl. A: 5-36). With a growing understanding of the epidemiology and genetics of IBD, it has been apparent to physicians that UC and CD may actually represent different forms of IBD. Therefore, the term "IBD" as used herein includes phenotypes thereof. Normally, CD is distinguished from UC because it is a disease proximal to the colon, perineal disease, with fistulas, histological granulomas and full thickness as opposed to limited mucosal disease. Generally, in CD, granulomas are evident in up to 50% of patients and fistulas in 25%.
    [0315]
    [0316]
    [0317] The presence of AIEC in the intestinal mucosa of a subgroup of patients with CD has been described (DarfeuiNe-Michaud A, et al. 2004; Martínez-Medina M. et al., 2009, Sivignon A, et al. 2017). The abundance of AIEC, defined as the percentage of AIEC within the E. coli population , is generally low and variable, ranging from 1% to 50% in patients with CD. For example, the inventors previously found that on average, AIEC isolates represented 9.3%, 3.7% and 3.1% of E. coli isolates in patients with ileal, ileocolonic and colonic CD, respectively (Martínez-Medina M. and García-Gil JL, 2014). In a particularly preferred embodiment said intestinal disease is CD, including ileal, ileocolonic and / or colonic CD.
    [0318]
    [0319] AIEC strains have also been associated with intestinal disease in animals, particularly in cats, dogs and pigs (Martínez Medina et al., 2009). In a previous study, Simpson et al. (Simpson et al., 2006) detected AIEC in boxer dogs suffering from granulomatous colitis, a disease with pathological features that overlap with CD, which supports the role of AIEC in human CD and in similar diseases in animals.
    [0320]
    [0321] In a preferred embodiment, said subject is a human subject. In another preferred embodiment, said subject is a mammal other than a human. Preferably, said animal is a cat, dog or pig.
    [0322]
    [0323] In a particular embodiment, the AIEC carrier status monitoring method as described hereinbefore is performed on a subject classified as an AIEC carrier having an intestinal disease, wherein said method comprises determining the presence and / or abundance of the AIEC phenotype after therapeutic treatment.
    [0324]
    [0325] In addition, it has been reported that AIEC strains can promote or perpetuate chronic inflammation. Therefore, various strategies directed against these strains of E. coli have been developed to promote their elimination in the intestine. Such strategies therefore constitute personalized treatments for subjects carrying AIEC who have an intestinal disease (also referred to herein as "patients carrying AIEC"), whose target is the microbiota.
    [0326]
    [0327]
    [0328] Accordingly, in a further aspect, the invention relates to a method for treating a subject having an intestinal disease as described herein, wherein said method comprises:
    [0329]
    [0330] i) selecting a subject having an intestinal disease in which said subject has been classified as a carrier of AIEC by a method of classification of the invention as described hereinbefore; ii) administering to said subject a therapeutically effective amount of a treatment intended to eliminate or decrease the levels of AIEC bacteria of the intestinal mucosa as described herein.
    [0331]
    [0332] A therapeutically effective amount will decrease AIEC levels by at least 10%, preferably at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or at least 95% in a functional or molecular method as described herein. The determination of AIEC levels can be performed on an intestinal sample of said subject as described hereinbefore.
    [0333]
    [0334] Therapeutic strategies aimed at eliminating or decreasing the levels of AIEC bacteria in the intestinal mucosa can be divided into two groups: i) strategies that eliminate AIEC, such as antibiotics or phage therapy; and ii) strategies that block bacterial adhesion to intestinal brush cells as described hereinafter (Sivignon A, et al. 2017).
    [0335]
    [0336] Antibiotic treatment may comprise administering a single antibiotic agent or various antibiotic agents in combination. For example, one or more antibiotics selected from the list consisting of ciprofloxacin, rifampicin, sulfamethoxazole, tetracycline and trimethoprim. In a particular embodiment, said treatment may comprise a combination of ciprofloxacin, tetracycline and trimethoprim (Subramanian S., et al., 2008).
    [0337] Bacteriophage therapy can be used as a strategy to select AIEC specifically as a target. This includes for example treatment with one or more bacteriophages, preferably those belonging to the family of Myovirídae virus . In a particular embodiment, said bacteriophage treatment can be a cocktail of three virulent bacteriophages, specifically LF82_P2, LF82_P6 and LF82_P8, which belong to the family Myoviridae, which was described as particularly effective in removing AIEC in the intestine of infected mice (Galtier M. et al., 2017).
    [0338]
    [0339] Strategies that target blocking bacterial adhesion can promote bacterial decolonization without altering the intestinal microbiota. It is expected that this therapeutic approach exerts a weak selective pressure and therefore limits the appearance of bacterial resistance.
    [0340]
    [0341] On the one hand, a reduction in the adhesion of AIEC bacteria can be obtained by probiotic strategies that comprise the administration of yeasts, since yeasts have numerous mannosylated structures in their cell wall that can interact with E. coli bacteria . It has also been described that yeasts protect the intestinal mucosa from lesions induced by AIEC bacteria and prevent the alteration of the barrier. In a particular embodiment, said therapy may comprise the administration of Saccharomyces cerevisiae. For example, it has been described that the strain of Saccharomyces cerevisiae CNCM I-3856 is capable of inhibiting the adhesion of AIEC to cultured intestinal epithelial cells and ileal enterocytes isolated from patients with CD (Sivignon et al.
    [0342] 2015).
    [0343]
    [0344] Other strategies aimed at inhibiting the adhesion of AIEC bacteria are based on FimH antagonists (for example, mannosides as receptor analogs). It has been described that the adhesion of AIEC to host cells is mainly mediated by type 1 fimbriae, which are rod-shaped organelles covered by FimH adhesin, which binds to mannosylated host glycoproteins. It has been described that AIEC strains preferably adhere to the brush border of the ileal enterocytes of patients with CD compared to enterocytes of control individuals, in a manner dependent on type 1 fimbriae (Barnich et al. 2007). A wide variety of FimH antagonists have been developed that block the FimH carbohydrate recognition (CRD) domain, in order to prevent bacteria from binding to intestinal epithelial cells and therefore they are removed from the intestine ( Sivignon et al. 2017).
    [0345]
    [0346] FimH antagonists with various chemical structures have been described as potential anti-adhesive agents against UTIs promoted by E. coli (Gouin et al., 2014; Mydock-McGrane et al., 2016; Grabosch et al., 2011 and, Firon et al., 1987). These include, but are not limited to, monovalent derivatives of heptyl mannose, monovalent thiazolylamino mannosides (TazMan) and HM-based glycopolymers (for example based on N-7- ( a -D-)
    [0347]
    [0348]
    [0349] manopyrosyloxy) heptyl methacrylamide), and can be used in the methods of the present invention. In the methods of the invention, the multivalent strategy in which FimH ligands are grafted in multiple copies can also be used in a common main structure (Bernardi et al., 2013).
    [0350]
    [0351] In addition, strategies aimed at eliminating AIEC can be combined with treatments traditionally used to treat CD therapeutically. The most appropriate treatment will generally be selected according to the location, severity and activity of the disease. Common pharmacotherapies currently used are anti-inflammatory chemicals derived from salicylic acid (i.e. mesalazine and sulfasalazine), corticosteroids (i.e. prednisone, methyl-prednisone and budesonide), antibiotics (i.e. metronidazole and ciprofloxacin), immunosuppressants (i.e. azathioprine and mercaptopurine ), the antimetabolite and methotrexate antifolate, and the so-called “biological” drugs that consist of antibodies against the tumor necrosis factor a (TNF a ), such as infliximab, adalimumab, cetolizumab pegol, etanercept and golimumab. Intestinal resection is also indicated in those patients with fulminant CD or with fistulas and for those patients who do not respond to any of the medications mentioned above (resistant cases). Other therapies such as autologous hematopoietic stem cell transplantation, or the use of probiotics and / or prebiotics are also contemplated.
    [0352]
    [0353] In a related aspect, the invention relates to compounds that eliminate or decrease AIEC bacteria levels for use in a method of treating a bowel disease in a subject carrying AIEC that needs it, in which said subject has been identified. by using a method of classification of the invention as described herein. Preferred features and embodiments are as described hereinbefore.
    [0354]
    [0355] The methods of the present invention could be implemented by a computer. Therefore, a further aspect of the invention relates to a method implemented by computer, in which the method is any of the methods disclosed herein or any combination thereof.
    [0356]
    [0357] It is indicated that any computer program capable of implementing any of the methods of the present invention or of being used to implement any of these methods or any combination thereof is also part of the present invention.
    [0358] It is also indicated that any device or apparatus comprising means for carrying out the steps of any of the methods of the present invention or any combination thereof, or carrying a computer program capable of, or for implementing any of the methods, is included. methods of the present invention or any combination thereof, forming part of the present specification.
    [0359]
    [0360] The methods of the invention may also comprise storing the results of the method in a data carrier, preferably wherein said data carrier is a computer-readable medium. The present invention further relates to a computer-readable storage medium having a computer program of the invention or the results of any of the methods of the invention stored therein.
    [0361]
    [0362] As used herein, "a computer-readable medium" may be any apparatus that may include storing, communicating, propagating or transporting the results of the determination of the method of the invention. The medium may be a system (or apparatus or device) electronic, magnetic, optical, electromagnetic, infrared or semiconductor or a propagation medium.
    [0363]
    [0364] Kit and use of a kit
    [0365] Still in a further aspect, the present invention relates to a kit for determining the genotype of the target SNPs in the genome of a strain of E. coli and its use in a method as described herein. The kit may also contain instructions that indicate how the materials can be used within the kit.
    [0366]
    [0367] The term "kit" or "test kit" indicates combinations of reagents and adjuvants required for an analysis. Although a test kit consists in the majority of cases in several units, one-piece analysis elements are also available, which should also be considered as a test kit.
    [0368]
    [0369] In a particular embodiment, said kit is suitable for determining in the genome of an E. coli strain, the genotype of one, two, three, four or more individual SNPs selected from the group consisting of: E1-E2_3.6, E3 -E4_4.3 (1), E3-E4_4.3 (2), E3-E4_4.3 (3), E3-E4_4.4, E5-E6_3.12, and E5-E6_3.16 = 3.22 (1) a E5-E6_3.16 = 3.22 (6), in which said kit It comprises one, two, three, four or more of the following:
    [0370] - an oligonucleotide specific for a target sequence comprising SNP E1-E2_3.6;
    [0371] - an oligonucleotide specific for a target sequence comprising SNP E3-E4_4.3 (1);
    [0372] - an oligonucleotide specific for a target sequence comprising SNP E3-E4_4.3 (2);
    [0373] - an oligonucleotide specific for a target sequence comprising SNP E3-E4_4.3 (3);
    [0374] - an oligonucleotide specific for a target sequence comprising SNP E3-E4_4.4;
    [0375] - an oligonucleotide specific for a target sequence comprising SNP E5-E6_3.12;
    [0376] - an oligonucleotide specific for a target sequence comprising SNP E5-E6_3.16 = 3.22 (1);
    [0377] - an oligonucleotide specific for a target sequence comprising SNP E5-E6_3.16 = 3.22 (2);
    [0378] - an oligonucleotide specific for a target sequence comprising SNP E5-E6_3.16 = 3.22 (3);
    [0379] - an oligonucleotide specific for a target sequence comprising SNP E5-E6_3.16 = 3.22 (4);
    [0380] - an oligonucleotide specific for a target sequence comprising SNP E5-E6_3.16 = 3.22 (5);
    [0381] - an oligonucleotide specific for a target sequence comprising SNP E5-E6_3.16 = 3.22 (6); Y
    [0382] - optionally, further comprising instructions for the use of said reagents in a method for determining the genotype of the target polymorphic site (s).
    [0383]
    [0384] In a preferred embodiment, said kit comprises at least one, two, three or four of the following:
    [0385] - an oligonucleotide specific for a target sequence comprising SNP E3-E4_4.3 (2);
    [0386] - an oligonucleotide specific for a target sequence comprising SNP E3-E4_4.4;
    [0387] - an oligonucleotide specific for a target sequence comprising SNP E5-E6_3.16 = 3.22 (2);
    [0388] - an oligonucleotide specific for a target sequence comprising SNP E5-E6_3.16 = 3.22 (3); Y
    [0389] - optionally, further comprising instructions for the use of said reagents in a method for determining the genotype of the target polymorphic site (s).
    [0390]
    [0391] In another particular embodiment, said kit is suitable for determining in the genome of a strain of E. coli, at least the genotype at the E3-E4_4.4 polymorphic site, and optionally to determine the genotype of the E5-E6_3 polymorphic sites. 16 = 3.22 (2) and E5-E6_3.12, in which said kit comprises:
    [0392] - an oligonucleotide specific for a target sequence comprising SNP E3-E4_4.4;
    [0393] - optionally, further comprising an oligonucleotide specific for a target sequence comprising SNP E5-E6_3.16 = 3.22 (2);
    [0394] - optionally, further comprising an oligonucleotide specific for a target sequence comprising SNP E5-E6_3.12; Y
    [0395] - optionally, further comprising instructions for the use of said reagents in a method for determining the genotype of the target polymorphic site (s).
    [0396]
    [0397] In a further particular embodiment, said kit is suitable for determining in a genome of the E. coli strain , at least the genotype at polymorphic site E6_3.16 = 3.22 (2), wherein said kit comprises:
    [0398] - an oligonucleotide specific for a target sequence comprising SNP E5-E6_3.16 = 3.22 (2);
    [0399] - optionally, further comprising an oligonucleotide specific for a target sequence comprising SNP E3-E4_4.4;
    [0400] - optionally, further comprising an oligonucleotide specific for a target sequence comprising SNP E5-E6_3.12; Y
    [0401] - optionally, further comprising instructions for the use of said reagents in a method for determining the genotype of the target polymorphic site (s).
    [0402]
    [0403] In a further embodiment, optionally in combination with one or more of the features or embodiments described above or below, this kit may further comprise one or more specific oligonucleotides for a target sequence comprising one of the other confirmed non-specific strain SNPs described in This document.
    [0404]
    [0405] In a particular embodiment, optionally in combination with one or more of the features or embodiments described above or below, said specific oligonucleotide (s) for a hybrid target sequence (n) with a sequence comprising the allelic form SNP target, as described earlier herein.
    [0406]
    [0407] In another particular embodiment, optionally in combination with one or more of the features or embodiments described above or below, said specific oligonucleotide (s) for a target sequence amplifies a sequence comprising the target SNP. In certain embodiments, the same oligonucleotides are used to amplify a sequence comprising other SNPs that are located within the same gene. Therefore, for example, oligonucleotide sequences can be designed to amplify a region of the E3-E4_4.3 gene comprising SNPs E3-E4_4.3 (1), E3-E4_4.3 (2) and E3-E4_4.3 ( 3) (see sequences SEQ ID NO: 11 and SEQ ID NO: 12 in Table 13, which were used in the examples as forward and reverse primers , respectively for the amplification of the E3-E4_4.3 gene).
    [0408]
    [0409] Preferably, said oligonucleotides comprise or consist of a sequence selected from the group consisting of the oligonucleotides listed in Table 13 or a sequence with an identity of at least about 90%, preferably at least about 95%, 96%, the 97%, 98% or 99%, for the respective target sequences.
    [0410]
    [0411] Accordingly, in a preferred embodiment, an oligonucleotide specific for a target sequence comprising SNP E3-E4_4.4 comprises or consists of SEQ ID. NO: 13, SEQ ID NO: 14, or a sequence with an identity of at least about 90%, preferably at least about 95%, 96%, 97%, 98% or 99%.
    [0412]
    [0413] In another preferred embodiment, an oligonucleotide specific for a target sequence comprising SNP E5-E6_3.16 = 3.22 (2) comprises or consists of SEQ ID NO: 23, SEQ ID NO: 24, or a sequence with an identity of at less about 90%, preferably at least about 95%, 96%, 97%, 98% or 99%.
    [0414]
    [0415] In a further preferred embodiment, an oligonucleotide specific for a target sequence comprising SNP E5-E6_3.16 = 3.22 (2) comprises or consists of SEQ ID NO: 30 (GCTGAACCATTCATTCACG), SEQ ID NO: 31 (TTATTGCAGAAAAGCGAGAGG), or a sequence with an identity of at least about 90%, preferably at least about 95%, 96%, 97%, 98% or 99%.
    [0416]
    [0417] In yet another preferred embodiment, an oligonucleotide specific for a target sequence comprising SNP E5-E6_3.12 comprises or consists of SEQ ID NO: 21, SEQ ID NO: 22 or a sequence with an identity of at least about 90% , preferably at least about 95%, 96%, 97%, 98% or 99%.
    [0418]
    [0419] In a particular embodiment, optionally in combination with one or more of the embodiments described above or below, said kit comprises reagents for performing a PCR reaction, which usually contains a DNA polymerase, such as Taq DNA polymerase (eg, Taq DNA polymerase hot starí), buffer, magnesium, dNTP and optionally other agents (for example, stabilizing agents such as gelatin and bovine serum albumin). In addition, mixtures of reagents for carrying out the quantitative or real-time PCR reaction also contain reagents for real-time detection and quantification of amplification products, which are well known in the art.
    [0420]
    [0421] Optionally, the kit may also include tubes and solvents suitable for DNA extraction, for example, a chloroform / methanol solution. Other features and preferred embodiments of the kit of the invention are as described herein throughout the specification.
    [0422]
    [0423]
    [0424] It is contemplated that any feature described herein may optionally be combined with any of the embodiments of any aspect of the invention, for example, any method, medical use, method of treatment, kit of parts and use of a kit of the invention; and any embodiment discussed in this specification can be implemented with respect to any of them. It will be understood that the particular embodiments described herein are shown by way of illustration and not as limitations of the invention. The main features of this invention can be used in various embodiments without departing from the scope of the invention. Those skilled in the art will recognize or determine through the use of only routine experimentation, numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of this invention and are covered by the claims.
    [0425]
    [0426] All publications and patent applications are incorporated herein by reference to the same degree as if it were indicated that each individual patent publication or application is incorporated by reference.
    [0427]
    [0428] The use of the word "one" or "one" may mean "one", but it is also compatible with the meaning of "one or more", "at least one" and "one or more than one". The use of the term "other" may also refer to one or more. The use of the term "or" in the claims is used to mean "and / or" unless explicitly stated that it refers only to alternatives or that the alternatives They are exclusive to each other.
    [0429]
    [0430] As used herein and in the claim / claims, the words "comprising" (and any form it comprises, such as "comprising" and "comprising"), "having" (and any form of that has, such as "have" and "has"), "that includes" (and any form it includes, such as "includes" and "include") or "that contains" (and any form it contains, such as "contains" and "contain") they are inclusive or open and do not exclude additional elements or steps of method, not mentioned. The term "includes" also expressly encompasses and discloses the terms "consists of" and "consists essentially of." As used herein, the term "consisting essentially of" limits the scope of a claim to the stages or specified materials and that which does not materially affect the basic (s) and new (s) characteristic (s) of the claimed invention. As used herein, the expression "consisting of" excludes any element, stage or component not specified in the claim except for, for example, impurities usually associated with the element or limitation.
    [0431]
    [0432] The term "or combinations thereof" as used herein refers to all permutations and combinations of the listed elements preceding the term. For example, it is intended that "A, B, C, or combinations of the same ”include at least one of: A, B, C, AB, AC, BC or ABC, and if the order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC or CAB . Continuing with this example, combinations containing repetitions of one or more elements or terms, such as BB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, etc., are expressly included. The person skilled in the art will understand that there is normally no limit on the number of elements or terms in any combination, unless otherwise evident from the context.
    [0433]
    [0434] As used herein, approximation words such as, "without limitation", "around", "around", "approximately" refer to a condition that when modified in this way means that It is not necessarily absolute or perfect, but should be considered close enough that those skilled in the art justify that it designates that the condition is present. The extent to which the description may vary depending on how large a change may be can be established and a person skilled in the art will still recognize that the modified characteristic still has the required characteristics and capabilities of the unmodified characteristic. In general, but subject to the previous comment, a numerical value in this document that is modified by an approximation word such as "approximately" may vary with respect to the value set in ± 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15%. Therefore, the term "approximately" may mean the indicated value ± 5 % of its value, preferably the indicated value ± 2% of its value, most preferably the term "approximately" means exactly the indicated value (± 0%).
    [0435]
    [0436] The following examples serve to illustrate the present invention and should not be construed as limiting the scope thereof.
    [0437]
    [0438] EXAMPLES
    [0439] Example 1.- Material and methods
    [0440] Strain selection and characterization
    [0441] Three pairs of isolated E. coli strains were selected in an earlier study (Martinez-Medina, M. et al, 2009), which consisted of each pair in an AIEC and a non-AlEC of identical pulse type and belonging to a phylogenetic group different (B1, B2 or D). The study from which the AIEC strains were obtained was approved on May 22, 2006 by the Clinical Research Ethics Committee of the Josep Trueta Hospital in Girona. Information on the patients from whom the strains were isolated is presented in Table 12. This table also shows the origin of the strains of the set used to validate the usefulness of the genetic differences found between pairs of strains as possible molecular markers. .
    [0442]
    [0443]
    [0444] Table 12. Information on the patients from whom the strains studied were isolated. The pairs of
    [0445] AIEC and non-AIEC strains for comparative genomic study are indicated in bold.
    [0446]
    [0447] State
    [0448] Id Age Pathological sex; Years since
    [0449] patient origin of the first diagnosis Treatment Strains sample
    [0450] 53 33 M C-CD; colon nd nd ECG01, ECG02,
    [0451] AIEC25
    [0452] 55 42 F CD, inactive;
    [0453] colon 12 mesalazine ECG18
    [0454] 61 31 F IC-CD, active;
    [0455] colon 0 none ECG09, ECG65 Control
    [0456] (rectorrhagia,
    [0457] background
    [0458] 69 67 M relatives of na na ECG41 cancer
    [0459] colorectal and
    [0460] polyposis); colon
    [0461] Control
    [0462] 70 83 M (diverticulosis); na na ECG22 colon
    [0463] Control
    [0464] 71 67 M (micropolis); na na ECG12 colon
    [0465] 72 27 F C-CD, active;
    [0466] colon 0 none ECG05, ECG64
    [0467] 77 48 F I-CD, active; 1 6- mercaptopurine colon AIEC21
    [0468] 79 25 F I-CD, inactive;
    [0469] ileum 0 mesalazine ECG19, ECG42 Control
    [0470] (constipation,
    [0471] 80 70 M na na ECG43 intestine syndrome
    [0472] irritable); colon
    [0473] Control (diarrhea
    [0474] and background
    [0475] 81 21 F relatives of na na ECG46 cancer
    [0476] colorectal);
    [0477] colon
    [0478] Control
    [0479] 82 29 F (rectorrhagia); na na ECG16 colon
    [0480] Control
    [0481] 83 61 F (rectorrhagia); na na ECG17 colon
    [0482] Control
    [0483] (background
    [0484] relatives of
    [0485] 84 59 F cancer na nare ECG49 colorectal);
    [0486] colon
    [0487] 89 31 M IC-CD, active;
    [0488] colon 0 none AIEC12 I-CD, inactive; medicine
    [0489] 109 21 M 8 alternative colon ECG21, ECG34
    [0490] 110 37 F IC-CD, inactive; 18 none ECG63, ECG57, colon AIEC20 111 49 F I-CD, inactive;
    [0491] colon 15 azathioprine ECG28, AIEC17
    [0492] 112 35 F C-CD, inactive;
    [0493] colon 19 azathioprine ECG26
    [0494] 113 43 F I-CD, inactive;
    [0495] colon 22 none ECG15 114 31 F IC-CD; colon> 2 nd AIEC02, AIEC05
    [0496] Control
    [0497] (rectorrhagia and
    [0498] background
    [0499] 119 35 M relatives of na na ECG23, AIEC19 cancer
    [0500] colorectal);
    [0501] colon
    [0502] I-CD, inactive; ECG11, 120 46 F 13 azathioprine ileum AIEC01
    [0503] IC-CD, inactive,
    [0504] 122 31 M perianal fistula; 10 azathioprine AIEC09, AIEC24 colon
    [0505] 123 36 M C-CD, inactive;
    [0506] ileum 7 none AIEC23 Control
    [0507] 124 37 M (rectorrhagia); na na ECG04 , ECG08, ileum AIEC07 Control
    [0508] 125 33 F (rectorrhagia); na na AIEC04 ileum
    [0509] Control
    [0510] 126 34 M (rectorrhagia); na na AIEC10 ileum
    [0511] Control
    [0512] 127 30 M (rectorrhagia); na na ECG13 colon
    [0513] Control
    [0514] 128 37 M (constipation); na na AIEC06 colon
    [0515] AIEC11, 132 48 F I-CD; ileum 9 nd AIEC14, AIEC15.1, AIEC16.1 142 41 M Control; na na colon AIEC08
    [0516]
    [0517] M: Man; F: Woman; na: not applicable; nd: no data; C-CD: colonic Crohn's disease; I-CD: ileal Crohn's disease; IC-CD: ileocolonic Crohn's disease. Active when CDAI> 150. The strain LF822 was also studied.
    [0518]
    [0519] The main characteristics of these strains are shown in Table 1. The criteria for
    [0520] selection, multiple loci sequence typing (MLST) and PFGE protocol are
    [0521] provided below in this document.
    [0522]
    [0523] Strain selection
    [0524]
    [0525] Three strains of AIEC isolated in a previous study were selected (Martinez-Medina, M.
    [0526] et al, 2009) based on the following criteria: i) have different origins
    [0527]
    [0528]
    [0529] phylogenetic, ii) show high rates of adhesion (> 15.9 bacteria / cell I-407) and invasion (surviving> 0.266% of the inoculum after 1 h of treatment with gentamicin) in Intestine-407 cells (I-407; ATCC CCL-6) and iii) have a genotype similar to ExPEC. The main characteristics of these strains are shown in Table 1. Non-AIEC strains with pulsotypes identical to those of each of the selected AIECs were searched in the set of E. coli obtained for each patient in the same previous study (Martinez -Medina, M. et al, 2009).
    [0530]
    [0531] Multiple loci sequence typing
    [0532] Multiple loci (MLST) sequence typing was performed in silico consulting for each genome, the sequences of 7 housekeeping genes ( adk, fumC, gyrB, icd, mdh, purA and recA) extracted from the E. coli MLST database . (University of Warwick). Each allele is identified by a numeric marker. The combination of the 7 numerical markers for each strain was collected and used to obtain the sequence types (ST) (Table 1).
    [0533]
    [0534] Pulsed Field Gel Electrophoresis
    [0535] It was checked whether the strains belonged to the same clone by pulsed field gel electrophoresis (PFGE) as described in CDCPulseNetUSA, 2004. The DNA, previously included in agarose blocks, was digested with XbaI 0.2 U / ^ l ( Takara Bio) according to the manufacturer's instructions. Genomic DNA digested by XbaI was analyzed on a 1% agarose gel in 0.5X Tris-boronic acid-EDTA buffer at 14 ° C using the CHEF-DR III system (Bio-Rad). The gel was run for 19 h at 6 V / cm, with initial and final switching times of 2.2 s and 54.2 s, respectively. The gel was stained with ethidium bromide (1. ^ g / rnl) and the images were normalized and calibrated in TIFF format using the GelComparII software (Applied Maths). Dendograms based on densitometric curve obtained from the gel image were created, using Pearson correlation coefficients, applying 0.5% optimization and 0.5% curve smoothing and the UPGMA clustering method. The dendogram of the strains is shown in Figure 2.
    [0536]
    [0537] Phenotypic characterization of the selected strains
    [0538] Phenotypic characterization of the selected strains was performed to determine adhesion and invasion of the Intestine-407 epithelial cell line (I-407 (ATCC CCL-6)) as well as survival and replication within two macrophage cell lines (J774A .1 (ATCC TIB-67) and THP-1 (ATCC TIB-202) of mouse and human, respectively) as detailed hereinbelow. Strains with an index of
    [0539]
    [0540]
    [0541] adhesion> 1, an invasion index> 0.1 that were reduced by 90% to 99.9% when the cytochalasin D microfilament inhibitor (C8273, Sigma-Aldrich) and the colchicine microtubule inhibitor (C9754, Sigma) were added -Aldrich), and with a replication rate> 100% in J774 and THP-1 were classified as AIEC strains in the present study.
    [0542]
    [0543] Adhesion and invasion studies using Intestine-407 epithelial cells
    [0544] Intestine-407 epithelial cell line (ATCC CCL-6) was used for adhesion and invasion assays. Cell culture, adhesion and triplicate invasion assays were performed as described previously (Boudeau, J. et al, 2009). Briefly, two 24-well plates containing 4x105 cells / well were infected that were incubated for 20 h at a multiplicity of infection of 10. Plaques were incubated in duplicate, one for the adhesion test and one for the invasion test, for 3 at 37 ° C in 5% CO2.
    [0545]
    [0546] For bacterial adhesion assays, cell monolayers were washed five times with phosphate buffered saline (PBS) and then lysed with 1% Triton X-100 (Sigma-Aldrich, St Louis, MO, USA). ). Adherent bacteria were quantified by plating them on Luria-Bertani (LB) agar (Liofilchem Srl, Italy). Plating was done in a maximum period of 30 min to avoid a bacterial lysis induced by Triton X-100. Adhesion capacity (I_ADH) was determined by calculating the average number of bacteria per cell. The isolates were considered adherent when I_ADH> 1.
    [0547]
    [0548] For bacterial invasion assays, the monolayers were washed twice with PBS after 3 h of infection, and freshly prepared cell culture medium containing 100 g / ml gentamicin was added and left for 1 h to remove extracellular bacteria . After cell lysis with 1% Triton X-100, the number of intracellular bacteria was determined by plating. Invasive capacity was expressed as the percentage of the initial inoculum that became intracellular: I_INV (%) = (intracellular bacteria / 4x 106 bacteria inoculated) x 100. The isolates were considered invasive when I_INV> 0.1%.
    [0549]
    [0550] The involvement of the cytoskeleton of the host cells was evaluated as described by Baumgart et al. (Baumgart, M. et al, 2007). I-407 cells were seeded at a density of 4x105 cells / well; after 24 hours, the monolayers were incubated with cytochalasin D (0.5. ^ g / ml) or colchicine (1. ^ g / rnl) for 30 minutes to depolymerize microfilaments and
    [0551]
    [0552]
    [0553] microtubules, respectively. Next, I-407 cell monolayers were proceeded as described for invasion assays. Finally, the inhibitory effect was determined and presented as the percentage of invasion index reduction.
    [0554]
    [0555] Survival and replication within macrophages
    [0556] The murine macrophage cell line J774A.1 (ATCC TIB-67) and the human cell line THP-1 (ATCC TIB-202) were used in survival and replication assays of the six sequenced strains of E. coli. It is culturing the J774 cells was performed and the ability of the isolated E. coli individual to survive and replicate inside macrophages as previously described (Glasser, A. et al, 2001) was determined. Briefly, J774 macrophages were seeded at 2x105 cells per well in two 24-well plates. Plates were incubated for 20 h in complete medium (RPMI 1640 (Lonza, Switzerland) supplemented with 10% heat-inactivated FBS (Gibco BRL) and 1% L-glutamine (Gibco BRL)). After incubation, the medium was replaced by freshly prepared medium and bacteria were seeded at a multiplicity of infection of 10. To promote internalization of the bacteria by macrophages, the plates were centrifuged at 900 rpm for 10 min and incubated for 10 additional min at 37 ° C in 5% CO2. Bacteria that were not phagocytosed were removed by including gentamicin (20 g / ml) in the medium. The human THP-1 cell line (ATCC TIB-202) was maintained in RPMI 1640 medium (Lonza, Verviers, Belgium) supplemented with 10% fetal bovine serum (Linus) (vol / vol). Incubation was performed at 37 ° C and in an atmosphere containing 5% CO2. THP-1 cells were seeded in two 24-well plates at a density of 5x105 cells / ml and grown in complete medium containing 20 ng / ml of 12-myristate-13-acetate forbol (PMA; Sigma-Aldrich ) for 24 hours to promote monocytic differentiation. After incubation, the medium was replaced by fresh medium (RPMI 10% heat-inactivated FBS), and bacteria were seeded at a multiplicity of infection of 100. Similar to the J774 monolayers, THP plates were centrifuged -1 at 900 rpm for 10 min and incubated for an additional 10 min at 37 ° C in 5% CO2. The cell monolayers were washed twice with PBS and freshly prepared cell culture medium containing 100 g / ml gentamicin was added to remove extracellular bacteria. After 40 min of incubation, a plate was washed twice with PBS and 0.5 ml of 1% Triton X-100 (Sigma-Aldrich) was added to each well for 5 min to lyse the eukaryotic cells. To determine the number of recovered intracellular bacteria, samples were diluted and plated on LB agar plates. The medium of the second plate was replaced with freshly prepared cell culture medium containing gentamicin
    [0557]
    [0558]
    [0559] 20. ^ G / ml and incubated for 23 h. The monolayer was then washed and treated with 1% Triton X-100 and the cell suspension was diluted and plated as described above.
    [0560]
    [0561] For both cell lines, intracellular bacteria were quantified as described for the invasion assay after 1 and 24 h of infection. The results are expressed as the average percentage of bacteria recovered at 1 h and 24 h after infection: I_REPL (%) = (CFU ml-1 at 24 h / CFU ml-1 at 1 h) * 100. Strains with higher I_ADH of 1 bacterium / cell, I_INV of 0.1% and I_REPL of 100% or greater were classified as AIEC strains in the present study.
    [0562]
    [0563] A selection of genes previously associated with the AIEC phenotype was examined either due to its higher prevalence in the pathotype ( lpfA154 genes (Dogan, B. et al, 2014; Chassaing, B. et al, 2011), gipA (Vazeille, E. et al, 2016), chuA (Dogan, B. et al, 2014), fyuA (Spurbeck, RR et al, 2012), afaC (Prorok-Hamon, M. et al, 2014), pduC (Dogan, B . et al, 2014) and ibeA (Cieza, RJ et al, 2015) or due to the presence of amino acid variants relevant to the pathotype (FimH (lebba, V. et al, 2012), OmpA (Rolhion, N. et al, 2015) and ChiA (Low, D. et al, 2013)) using alignment with BLASTn (Altschul, SF et al, 1997) and with ClustalW (Thompson, JD et al, 1994).
    [0564]
    [0565] Extraction and sequencing of genomic DNA
    [0566] Genomic DNA was extracted from bacterial cells grown in Luria-Bertani (LB) medium, using Wizard® genomic DNA purification kit (Promega) according to the manufacturer's instructions; Samples were treated with RNase A provided with the kit. DNA purity was determined using a NanoDrop ND-100 spectrophotometer (NanoDrop Technologies), the amount of DNA was measured using a Qubit® 2.0 fluorometer (Life Technologies) and DNA integrity and RNA removal in agarose gels was examined . Unique bands of approximately 23 Kb were identified in agarose gels. The absorbance ratio of 260/280 of the DNA preparations ranged between 1.8 and 2, and the amount of DNA obtained ranged from 15 to 30. G, indicating sufficient quality of genomic DNA for genome sequencing. Two sequencing platforms were used: Illumina HiSeq and PacBio Biosciences as described hereinafter.
    [0567]
    [0568]
    [0569] For sequencing with Illumina, sequencing libraries were prepared from DNA samples using the TruSeq Illumina kit in EA Quintiles. Briefly, 1. g of genomic DNA was fragmented to give -200 bp fragments using a Covaris E210 ultrasound. Then the ends of the fragmented DNA were blunt and a single "A tail" was added to the 3 'end of each fragment to facilitate ligation of sequencing adapters containing a single protruding T base. DNA bound by adapters was amplified by polymerase chain reaction to increase the amount of DNA ready for sequencing Final DNA libraries were analyzed to determine size distribution and quality using an Agilent bioanalyzer (DNA 1000 kit, Agilent # 5067-1504 ), were quantified using Picogreen (Life Tech No. P11496) and normalized to a concentration of 2 nM. Equal volumes of the standardized DNA libraries were combined and the combined DNA was used to prepare a flow cell using the V3 kit of Illumina TruSeq matched end cluster (Illumina No. PE-401-3001) The combinations were denatured using freshly prepared 0.1 N NAOH and diluted Rum up to 20 pM in previously cooled hybridization buffer. The combinations were further diluted to 9 pM, and one aliquot of each was placed in an Illumina cBot instrument to produce clusters through bridge amplification. Sequencing was performed on an Illumina HiSeq 2000 device using a paired-end sequencing of 100 bases plus an index cycle of 7 bases.
    [0570]
    [0571] For sequencing with PacBio, DNA libraries were prepared following PacBio guidelines and sequenced on SMRT chips using Pacific Biosciences RS sequencing technology (Pacific Biosciences, Menlo Park, CA, USA) in EA Quintiles. 10. ^ G of genomic DNA was purified using the PowerClean® DNA cleaning kit (MO BIO Laboratories) and then cut to 2 kb using a Covaris® Adaptive Focused Acoustics instrument. The cut DNA was purified using magnetic beads and verified in a bioanalyzer. Library preparation was performed using Pacific Biosciences 2.0 template DNA preparation kit (3 Kb - 10 Kb). Size selection and library purification were performed using 0.6X AMPure beads (Beckman-Coulter Genomics). Each library was bound to C2 DNA polymerase, loaded on an SMRT chip, and sequencing was observed using two 45 min films for each chip. The quality analysis of the raw data was performed with PRINSEQ.
    [0572]
    [0573] De novo genome assembly
    [0574] The proposed genomes were assembled de novo (combining both platforms) using the SPAdes (ABL) software (Bankevich, A. et al, 2012) and annotated using the BG7 bacterial genome annotation system (Pareja-Tobes, P. et al , 2012). To assign the gene function, the positive result was chosen with the lowest E-value obtained after the analysis against the UniProt database. The genomes obtained have been deposited in the European nucleotide archive with the registration numbers ERS1456453 (AIEC17), ERS1456454 (ECG28), ERS1456455 (AIEC01), ERS1456456 (ECG11), ERS1456457 (AIEC07) and ERS1456458 (ECG04).
    [0575]
    [0576] Comparative genomics of strain pairs
    [0577] Differences in genomic structure and gene content
    [0578] MAUVE 2.3 (Darling, AE et al, 2010) was used to identify structural rearrangements and inversions throughout the genome of the strain. CRISPRFinder (http://crispr.i2bc.parissaclay.fr/) (Grissa, I. et al, 2007) was used to study pooled and regularly intersciated palindromic repetitions (CRISPR). To find differences in gene content, a comparison was made using BLASTP (cut-off point of E-value 1e-5) and Markov grouping (inflation factor of 2.0) using ORTHOVENN (Wang, Y. et al, 2015) using protein sequences. A correction was made with local BLASTn (Altschul, SF et al, 1997) to include genes located at the beginning or end of the condoms.
    [0579]
    [0580] Single nucleotide polymorphisms in coding regions
    [0581] Harvest program for rapid center alignment genome (Treangen, TJ et al, 2014) to detect SNPs between strains of the same pair is used. To maximize sensitivity, the best-noted AIEC genome was used at the time of analysis, UM146 (NC_017632.1) (Krause, DO et al, 2011), as the reference genome. For the purpose of this study, only SNPs between pairs of AIEC and non-AIEC strains that produced a non-synonymous amino acid change in the coding regions and that were not present in highly variable regions or in regions were chosen for examination. ends of the spouses. These SNPs are called "selected SNPs."
    [0582]
    [0583] Selected SNPs were validated by a new Sanger sequencing. Using Primer3, primers were designed to flank at least 100 bp in the 5 ’and 3’ direction of the SNP position to achieve good sequence quality to assign nucleotides in the SNP position. Care was taken to design primers, targeting conserved regions between several strains of AIEC and non-AIEC. All the
    [0584]
    [0585]
    [0586] primers were further analyzed with NetPrimer to select the optimal primer pairs. Validated polymorphisms are called “confirmed SNPs.” The primers and PCR conditions used are presented in Table 13 below.
    [0587]
    [0588]
    [0589]
    [0590] It should be noted that some SNPs were found with ambiguous nucleotide peaks (called "SNPs with overlapping peaks") representing a mixture of two nucleotides in a given position. The possible cause of these ambiguous nucleotide peaks in silico was analyzed using a combination of BLASTn gene searches (Altschul, SF et al, 1997) and inspection of readings via Tablet (Milne, I. et al, 2013) The next stage in the selection of SNPs was the in silico identification of specific SNPs of strain; these SNPs were discarded from the analysis.
    [0591]
    [0592] To determine the strain specificity of the "confirmed SNPs", the sequences containing the variable position of the six strains sequenced in this study were aligned as well as in 3 strains of AIEC (UM146, LF82, NRG857c), 9 of ExPEC (CFT073 , 536, UMN026, S88, APEC01, 042, EDL933, O157 Sakai, E24377A) and 3 diners (HS, K12 MG1655, ED1a) and the distribution of SNP between the strains was further determined. The distribution within the set of strains was analyzed. of SNPs that presented variability in the base under study among the strains and that were produced within genes that were widely distributed among most strains. The genes that contained "confirmed SNPs" were classified using the gene ontology consortium (Gene Ontology Consortium, 2015) and Pfam databases (Finn, RD et al, 2016).
    [0593]
    [0594] SNP distribution among a set of strains
    [0595] To analyze the possible application of "confirmed SNPs" as biomarkers for the specific identification of AIEC, a total of 16 SNPs present in 9 genes in a wider set of strains of 22 AIEC strains and 28 non-AlEC (Martinez) were examined. -Medina, M. et al, 2009) (Tables 7 and 10) by Sanger sequencing.
    [0596]
    [0597] Statistic analysis
    [0598] Differences in nucleotide distribution present in each polymorphic site between pathotype and phylogenetic groups were calculated using the X2 test. The non-parametric Kruskal-Wallis test was used to compare the mean adhesion and invasion rates between more than two nucleotide variants, and the Mann-Whitney U test was performed to analyze two-to-two comparisons. A binary logistic regression analysis was used as a model to predict the AIEC pathotype according to the nucleotide present in a particular SNP position. A value of p <0.05 was considered statistically significant in all cases.
    [0599]
    [0600]
    [0601] Example 2.- Characterization of the three pairs of strains selected
    [0602] In the present study, three strains of AIEC and three corresponding non-AlEC homologs were selected with which the AIEC strains shared PFGE patterns (Figure 1), type sequences (ST), phylogenetic origins and identical virulence genes (Table 1 ) for the sequencing of their genomes. As expected, AIEC strains had higher rates of adhesion and invasion than their non-AIEC counterparts. However, non-AIEC strains also had the ability to survive and replicate within J774 murine macrophages but not in human THP-1 macrophages, with the exception of strain ECG28.
    [0603]
    [0604] Similar genome lengths between strains were obtained, ranging from 4,825 to 5,213 Kb for the AIEC and non-AIEC strains (Table 2), and no significant structural differences were found between the pairs of strains (Figure 2). An inversion was detected in all two-to-two comparisons, but without being shared between the three pairs of strains.
    [0605]
    [0606] Table 2. Assembly characteristics of sequenced genomes of AIEC / non-AIEC.
    [0607]
    [0608] Code size
    [0609] Strain GC (%) a N50 (kb) b Registration No.
    [0610] (kb) (no.)
    [0611]
    [0612] AIEC17 4,958 400 50.42 247 ERS1456453
    [0613]
    [0614] ECG28 4,981 464 50.38 214 ERS1456454
    [0615]
    [0616] AIEC01 5,213 333 50.48 186 ERS1456455
    [0617]
    [0618] ECG11c 5,212 25 50.56 555 ERS1456456
    [0619]
    [0620] AIEC07 4,825 374 50.62 187 ERS1456457
    [0621]
    [0622] ECG04 5,013 836 50.46 261 ERS1456458
    [0623] to GC (%) x - , C - on ! had defined as (G + C) / (A + T + G + C) x100.
    [0624] b N50, the length of the shortest with 50% of the assembly.
    [0625] c This strain was sequenced by PacBio (library with 10 kb insert) and assembled with an HGAP 3 tool.
    [0626]
    [0627] The genes that had previously been described that were associated with AIEC were searched in the genomes of the six strains. It was found that gipA, chuA and fyuA were present in the three strains of AIEC but also in their non-AIEC counterparts (Table 1). Other genes were not present in any strain ( afaC) or were present only in a single pair of strains ( lpfA154, pduC and ibeA).
    [0628]
    [0629] A similar situation was found with respect to the gene variants of fimH, ompA and chiA. Although specific changes in the amino acid sequences of proteins encoded by these genes have been associated with increased adhesion / invasion capacity (Dreux, N. et al, 2013; Rolhion, N. et al, 2010; Low, D. et al , 2013), no such differences were observed between isolates of the pairs of strains (Table 3). CRISPR analysis was also performed, and equal profiles were obtained for the AIEC17-ECG28 and AIEC07-ECG04 pairs; CRISPR not confirmed in AIEC01 or ECG11 were recognized. Therefore the Strain pathotype would not be determined by differences in the sequences of these genes.
    [0630]
    [0631] Table 3. Distribution of amino acid substitutions in three genes previously associated with AIEC pathogenesis in AIEC / non-AIEC strains. The amino acid substitutions that were previously associated with AIEC are marked in bold. The first letter corresponds to the amino acid present in the strain studied; The last letter indicates the amino acid found in the K-12 commensal strain.
    [0632] Strains compared
    [0633]
    [0634] Genes
    [0635] AIEC17-ECG28 AIEC01-ECG11 AIEC07-ECG04
    [0636] with AIEC
    [0637]
    [0638] f im H 23 A27V, S70N, N78S A27V, H166R A27V, K32N *
    [0639]
    [0640] P46N, D47S, N48V, I49E,
    [0641] D46N, V114I , V196A, T224N V114I , A125S, P128Y, ompA25 A125S, P128Y, GASF130-,
    [0642] A272G GASF130-, D135N, N172H,
    [0643] L182M,
    [0644]
    [0645] T100N, G166S, M182T, A200S,
    [0646]
    [0647] T286S, ETPV311, N326S,
    [0648]
    [0649] S335V, Q362K, E370K, V378A,
    [0650] chiA26 Q362K, E370K, V378A, V388E, Absent
    [0651] V388E , M396L, I414V, N427D,
    [0652]
    [0653] T517A, E548V , A681D, R696K,
    [0654]
    [0655] S804S, Y810H, G811P
    [0656]
    [0657] * Non-synonymous SNPs described in this study by comparative genomics, not associated with AIEC patotype only present in AIEC07.
    [0658]
    [0659] Example 3.- Comparative genomics of pairs of AIEC / non-AIEC strains
    [0660] The genomes of the three pairs of AIEC / non-AIEC strains within the pairs were compared to identify differences in gene content and SNP that might be involved in the AIEC phenotype.
    [0661]
    [0662] 3.1 Evaluation of differences in gene content
    [0663] Sequences encoding homologous proteins were identified. A total of 5208 orthologous clusters were obtained, 3327 (63.9%) of which were common among the six strains (Figure 3a). These genes represented 80%, 77% and 81% of the genomes in the AIEC17-ECG28, AIEC01-ECG11 and AIEC07-ECG04 pairs, respectively. The pairs of strains that belonged to the phylogenetic groups B2 and D shared a greater proportion of orthologous gene clusters (9.2-9.6% of their genomes) compared to the proportion that the B1 strains shared with those of B2 (2.5-2.6%) or with those of phylogenetic group D (2.2-2.3%) (Figure 3b). The high similarity between pairs of strains was also revealed in terms of gene content; since the strains that made up the same pair shared more than 99.2% of orthologous gene clusters.
    [0664]
    [0665] None of the clusters was shared by the three AIEC strains, not even exclusively by two of them (Figure 3a), which indicates the absence of specific AIEC genes that are present in all AIEC strains. However, within each pair of strains, genes were found exclusively in the AIEC strain (Table 4). AIEC17 contains two genes that code for uncharacterized proteins (YgiZ and YeeW), a gene that codes for a cyanate transporter and a gene that codes for a TraR family protein that is involved in a quorum sensing process30. In the case of AIEC01, 33 of the genes present in their genome were absent from the ECG11 genome. Of these 33 genes, 20 encode proteins of unknown or generic function, six are related to transmembrane transport, four are involved in the regulation of transcription, and three contribute to the assembly of flagella. Finally, compared to ECG04, AIEC07 harbors three proteins of unknown function (one of which is a specific protein of uropathogenic E. coli ), a protein related to intracellular iron transport (TonB) and the UpaH autotransporter. The latter protein mediates biofilm formation in the uropathogenic strain CFT073 (Allsopp, LP et al, 2010). Biofilm formation is also a phenotypic trait of AIEC strains (Martínez-Medina, M. et al, 2009).
    [0666]
    [0667]
    [0668]
    [0669]
    [0670]
    [0671]
    [0672]
    [0673]
    [0674] 3.2 Detection of SNPs associated with AIEC
    [0675] The approach used to identify SNPs associated with AIEC was characterized by including only those nucleotide positions that varied between the strains of a pair and at the same time they were also located in homologous sequences of an AIEC reference genome (strain UM146). A total of 286 polymorphisms were found; the majority (213) of the SNPs were located in gene coding sequences (table 5).
    [0676]
    [0677] Table 5. Number of SNPs in the pairs of sequenced AIEC / non-AIEC strains.
    [0678]
    [0679] AIEC17-ECG28 AIEC01-ECG11 AIEC07-ECG04
    [0680] Total SNPs 51 126 109
    [0681] Total SNPs in genes 40 91 82
    [0682] SNPs selected * 1 20 (7) 10 (5) 30 (19)
    [0683] SNPs confirmed * 2 4 (4) 7 (3) 9 (4)
    [0684] SNPs studied in a
    [0685] strain set * 3 4 (4) 4 (2) 8 (3)
    [0686]
    [0687] * The number of genes in which SNPs are located is indicated in parentheses.
    [0688] 1 SNPs that meet the following criteria: (I) produce a non-synonymous amino acid change; (II) they are not located at the ends of a spouse; and (III) were bioinformatically validated by ClustalW. 2 Validated by the Sanger method.
    [0689] 3 confirmed SNPs that were not strain specific (and four strain specific SNPs for validation).
    [0690]
    [0691] Only 20 of the 60 genomic differences that were re-sequenced were confirmed by Sanger sequencing. The location of confirmed SNPs, nucleotide variants and gene functions are shown in Table 6.
    [0692]
    [0693]
    [0694] Table 6. Location of confirmed SNPs, nucleotide variants and gene functions.
    [0695]
    [0696] Location
    [0697] Position
    [0698] SNP in Variant of
    [0699] the nucleotide genome * 1 Ontology Family Name of ID UM146 (
    [0700] NC 017 of AIEC (AIEC / distinct protein protein genes (AIEC position)
    [0701] 632)
    [0702] with you)
    [0703]
    [0704] E1-E2_3.4 1960688 8: 204059 C / T PF00392 Regulator; GO: 0003677 transcript of PF07702 GO: 0003700; the GntR GO family: 0006351
    [0705] E1-E2_3.6 2503226 105: 325 C / T Phage protein PF06174
    [0706]
    [0707] E1-E2_3.7 51330 3: 50414 T / C Serine peptidase, PF13365; GO: 0004252
    [0708] DegQ PF13180;
    [0709] PF00595
    [0710] 4195813
    [0711] E1-E2_5 51: 69 G / T PF07715 GO Conveyor: 0009279;
    [0712] Vitamin B12, GO: 0015235 BtuB GO: 0006811
    [0713] GO: 0046872; GO: 0046930; GO: 0015288 GO: 0004872 E3-E4_4.3 1425714 3: 167, 173, C / Y, Y / Y, T / K Possible protein PF06174
    [0714] 1425708 209 not characterized
    [0715] 1425672
    [0716]
    [0717] E3-E4_4.4 1433063 84: 1126 R / R dGTPase PF00350 GO: 0005525
    [0718] E3-E4_4.7 1430771 80: 920, S / S, S / S, Y / Y Protein of PF13990
    [0719] 1431049 932, 1013 chemotaxis
    [0720] 1431061
    [0721] E5-E6_3.1 4654977 3: 6356 A / C FimH PF00419; GO: 0007155
    [0722] PF09160 GO: 0009289
    [0723] E5- 4271710 83: 442 A / G Beta subunit PF08442 GO: 0005524; E6_3.12 of succinyl-CoA GO: 0000287;
    [0724] ligase GO: 0030145
    [0725] GO: 0004775; GO: 0006099
    [0726] E5-E6_ 2212719 51: 418, Y / Y, S / S, R / R Protein of PF06316 GO: 0009279; 3.16 = 3.22 2212845 544, 545, M / M, Y / Y, S / S Ail / Lom family of GO: 0016021
    [0727] 2212846 633, 646, enterobacteria
    [0728] 2212934 650
    [0729] 2212947
    [0730] 2212951
    [0731]
    [0732] E5- 2217953 62: 583 R / R Possible PF00877
    [0733] E6_3.17 component of
    [0734] profago
    [0735] * 1 A: adenine; C: cytosine; G: guanine; K: guanine or thymine; M: adenine or cytosine; R: adenine or guanine; S:
    [0736] guanine or cytosine; T: thymine; W: adenine or thymine; Y: cytosine or thymine.
    [0737]
    [0738] It should be noted that 14 of these SNPs (70%) had overlapping peaks in Sanger chromatograms (Table 6). The hypothesis was raised that i) strains with ambiguous bases could present more than one copy of the relevant gene in their genomes or ii) the existence of intraclonal variability in the polymorphic site. To identify which of these possibilities resulted in SNPs with ambiguous bases, first searches were performed using BLASTn (Altschil, SF et al, 2009) in the genomes of strains and the genome reference strain AIEC for Search for duplicate genes, and secondly, the reads obtained from the next generation sequencing (NGS) were analyzed using Tablet (Milne, I. et al, 2013) to confirm the observations. The duplicated genes showed a single or major nucleotide in the SNP that differed from the nucleotide present in the other copy of the gene (this was the case for SNPs found in genes E3-E4_4.3, E3-E4_4.4 and E3-E4_4 .7). Genes that were not duplicated showed a single BLASTn result and two different nucleotides that had an almost equal frequency in sequencing readings (this was the case of SNPs found in genes E5-E6_3.16 = 3.22 and E5-E6_3 .17). Therefore, it was concluded that the overlapping peaks were not due to technical artifacts.
    [0739]
    [0740] In this study, a comparative genomic analysis between AIEC and non-AIEC strains that are considered clones with respect to their PFGE patterns has been performed for the first time. Compared to previous comparative genomics studies, the methodology excludes the detection of genomic variations that are inherent, for example, in the phylogenetic origin of the strains. This approach has been proposed by the inventors with the aim of increasing the possibility of identifying molecular signatures that are specific to AIEC. In fact, the previous difficulties in discovering a specific feature for AIEC strains can be explained by the fact that non-AIEC strains of non-AIEC and non-AIEC strains have usually been compared (Dogan, B. et al, 2014; Desilets , M. et al, 2015). In addition, most of the AIEC studied have belonged to a particular phylogenetic group (O'Brien, CL et al, 2016; Deshpande, NP et al, 2015). Researchers have chosen to sequence pairs of strains belonging to different phylogenetic groups (B1, B2 and D) and the distribution of the differences found in a collection that included isolates of different phylogenetic origin has been studied to determine whether they were universal among strains of AIEC and were absent from non-AIEC strains.
    [0741] No significant differences were found in the genomic structure or even in the gene content between the pairs of AIEC and non-AlEC strains studied, confirming their close identity as seen by PFGE. No gene was found that was present in at least two strains of AIEC and absent of all strains -no-AIEC. However, small differences in gene content were observed between strains of the same pair. However, this result must be confirmed because it could be a consequence of an incomplete assembly of the genome (those genes that appear fragmented in the assembly would not have been found). In general, the results support the idea that the AIEC phenotype is not determined by the presence or absence of a particular gene, as observed by O'Brien et al. (O'Brien, CL et al, 2016) in sequence type strains ST95.
    [0742]
    [0743] In an additional attempt to explain the phenotypic differences observed between peers, we sought to identify SNPs that were differentially present in strains of AIEC and their non-AIEC counterparts. The rate of occurrence of such SNPs that were further validated by Sanger sequencing was low. This can be explained by the accumulation of small errors during library construction and sequencing caused by the imperfect fidelity of DNA polymerases and the intrinsic error rate of the sequencing platform, and by errors derived from the parameters used for assembly of the readings (Olson, ND et al, 2015; McElroy, K. et al, 2014). Occasionally there was observed nucleotide variability and on the resulting contig consensus assembly does not represent all readings (reads).
    [0744]
    [0745] Example 4.- Distribution of SNPs in a collection of AlEC / non-AlEC strains
    [0746] Nucleotide variability within SNPs identified in a collection of AIEC and non-AIEC strains was studied to validate or refute the hypothesis that confirmed SNPs represent molecular signatures to apply in the specific identification of the AIEC pathotype. Sixteen SNPs were studied in 22 strains of AIEC and 28 non-AIEC strains isolated from healthy subjects and patients with CD and belonging to several phylogenetic groups (A (n = 9), B1 (n = 7), B2 (n = 28 ) and D (n = 5)) (Table 7). Only "confirmed SNPs" that were not strain specific after the in silico evaluation were selected , because strain specific SNPs would not be useful for the identification of AIECs. Four SNPs considered strain specific were also analyzed according to the result obtained the in silico tests
    [0747]
    [0748]
    [0749] (E1-E2_3.4, E1-E2_5, E1-E2_3.7 and E5-E6_3.1) to confirm that they were strain specific.
    [0750]
    [0751] Table 7. Collection of E. coli strains used for validation of the suitability of SNP variants as supposed signatures for the detection of AIEC. The origin of the phylogenetic group, the type of patient from which the strain was isolated (subject with Crohn's disease (CD) or healthy (H)) and the rates of adhesion and invasion are indicated. Additional information on the features can be found
    [0752] of the strains in Martinez-Medina, et al. (2009).
    [0753] Strain Index Group Phenotype Origin Index of phylogenetic replication index adherence to intra-macrophage b invasion in J774c AIEC10 A AIEC H 5.9 0.226 1414
    [0754] AIEC19 A AIEC H 2.4 0.111 1568
    [0755] AIEC23 A AIEC CD 9.7 0.568 2362
    [0756] AIEC24 TO AIEC CD 2 0.309 1626
    [0757] ECG16 A no- AIEC H 0 0.002 na
    [0758] ECG22 A no- AIEC H 0 0.006 na
    [0759] ECG18 A no- AIEC CD 0.1 0.001 na
    [0760] ECG19 A no- AIEC CD 0 0.023 na
    [0761] ECG65 A no- AIEC CD 0.1 0.001 na
    [0762] AIEC07 B1 AIEC H 20 0.565 1693
    [0763] ECG04 B1 no- AIEC H 0.5 0.023 813
    [0764] ECG46 B1 no- AIEC H 0.0 0.001 na
    [0765] ECG02 B1 no- AIEC CD 0 0.001 na
    [0766] ECG21 B1 no- AIEC CD 6.1 0.033 na
    [0767] ECG63 B1 no- AIEC CD 0 0.003 na
    [0768] ECG64 B1 no- AIEC CD 0.3 0.019 na
    [0769] AIEC04 B2 AIEC H 21.6 0.32 585
    [0770] AIEC06 B2 AIEC H 10.2 0.177 1718
    [0771] AIEC08 B2 AIEC H 1.1 0.172 105
    [0772] LF82 B2 AIEC CD 25.7 2,261 777
    [0773] AIEC01 B2 AIEC CD 15.9 0.284 1567
    [0774] AIEC02 B2 AIEC CD 0.9 0.802 2188
    [0775] AIEC05 B2 AIEC CD 9.4 0.202 705
    [0776] AIEC09 B2 AIEC CD 5.4 0.216 2562
    [0777] AIEC11 B2 AIEC CD 4.4 0.508 848
    [0778] AIEC12 B2 AIEC CD 22.3 0.142 94
    [0779] AIEC14 B2 AIEC CD 9.8 0.238 801
    [0780] AIEC15.1 B2 AIEC CD 10 0.305 660
    [0781] AIEC16.1 B2 AIEC CD 9.7 1,400 921
    [0782] AIEC21 B2 AIEC CD 17 0.109 1297
    [0783] AIEC25 B2 AIEC CD 2.8 0.482 776
    [0784] ECG08 B2 no- AIEC H 0.3 0.004 na
    [0785] ECG12 B2 no- AIEC H 0.1 0.003 na
    [0786] ECG13 B2 no- AIEC H 0.2 0.004 na
    [0787] ECG17 B2 no- AIEC H 0.2 0.019 na
    [0788] ECG41 B2 no- AIEC H 0.3 0.003 na
    [0789] ECG43 B2 no- AIEC H 0.5 0.018 na
    [0790] ECG49 B2 no- AIEC H 0.3 0.008 na
    [0791] ECG01 B2 no- AIEC CD 0.2 0.002 na
    [0792] ECG05 B2 no- AIEC CD 0 0.039 na
    [0793] ECG09 B2 no- AIEC CD 0.2 0.001 na
    [0794] ECG15 B2 no- AIEC CD 5.3 0.038 na
    [0795] ECG26 B2 no- AIEC CD 0.2 0.005 na
    [0796] ECG42 B2 no- AIEC CD 0 0.032 na
    [0797] AIEC17 D AIEC CD 21.6 0.266 1053
    [0798] AIEC20 D AIEC CD 14.2 0.125 344
    [0799] ECG28 D no- AIEC CD 2.2 0.057 1060
    [0800] ECG34 D no- AIEC CD 0.4 0.019 na
    [0801] ECG57 D no- AIEC CD 11.8 0.013 na
    [0802] Atypical ECG23 non-AIEC H 0.9 0.052 na
    [0803] a Number of bacteria per cell I-407. b Percentage of intracellular bacteria after 1 h of treatment with gentamicin in relation to the inoculum. c Percentage of intracellular bacteria at 24 h after infection in relation to the number after 1 h of gentamicin treatment. na; not analyzed
    [0804]
    [0805] Interestingly, some nucleotide variants were found that appeared more
    [0806] frequently in AIEC strains than in non-AIEC strains (Table 8).
    [0807]
    [0808]
    [0809]
    [0810] In particular, only thymidine strains were found in AIEC strains in SNP E3-E4_4.3 (2), while the variant containing cytosine was more frequent within non-AIEC strains. Similar results were obtained when the analysis was restricted to strains of phylogenetic group B2 (p = 0.037); there, the AIEC strains (n = 6) were again the only ones that presented thymidine, and cytosine was also more prevalent in non-AIEC strains than in AIEC strains (n = 10 and n = 7, respectively). This gene was present in all strains studied, and SNP variants were not associated with the origin of the phylogenetic group of the strains but only with the phenotype of AIEC. Another interesting SNP was present in the E3-E4_4.4 gene, in which 42.86% of non-AIEC strains had guanine while less than 10% of AIEC strains had this variant. However, in this case, not all strains harbored the gene, as is the case with strain LF82. Finally, a guanine in SNP E5-E6_3.16 = 3.22 (2) was more frequently found in AIEC strains, while a cytosine in this position was associated with non-AIEC strains. If only B2 strains are considered, the cytosine variant is found exclusively in non-AIEC strains (n = 5), while the guanine variant is specific for AIEC strains (n = 4) (p = 0.007); therefore, it could be of interest as a biomarker for the strains of AIEC of phylogenetic group B2. However, the percentages of strains presenting these two variants are low (41.7% of non-AIEC B2 strains and 30.8% of AIEC B2 strains).
    [0811]
    [0812] From a functional point of view, the E5-E6_3.16 = 3.22 gene codes for a protein of the Ail / Lom family of enterobacteria. This family of proteins includes outer membrane proteins that are involved in bacterial virulence, such as OmpX (in E. coli and Enterobacter cloacae) (Meng, X. et al, 2016) and PagC (in Salmonella typhimurium) (Pulkkinen, WS and Miller, SI, 1991). It has been reported that these proteins play roles in cell adhesion and intra-macrophage survival, respectively. The gene that contains SNP E3-E4_4.4 encodes a dGTPase that is a member of the dynamine type family of proteins (PF00350), whose function in bacteria is still unknown. Finally, the function of E3E4_4.3 is unknown, although it shares 97.2% (74.5% coverage) of amino acid sequence homology with the hypothetical yeeT protein. The low sequence homology of these genes with genes in the currently available databases makes it difficult to identify with confidence the proteins encoded by these genes. Therefore, the creation of isogenic mutants will be necessary to understand the function biological of these proteins and demonstrate the effects of their possible amino acid variations.
    [0813]
    [0814] Example 5.- SNP in relation to adhesion and invasion capacity
    [0815] As expected, the strains carrying SNP variants associated with the AIEC patotype showed a higher rate of adhesion and invasion (Figure 4). The only exception was SNP E5-E6_3.16 = 3.22 (2), in which, despite the higher adherence rate for the AIEC-associated variant, it did not reach statistical significance. In turn, strains with guanine in SNP E3-E4_4.4 showed lower rates of adhesion and invasion. An additional polymorphism, SNP E5-E6_3.16 = 3.22 (3), showed significant differences; strains with adenine in this SNP had an increased invasion capacity.
    [0816]
    [0817] SNPs E5-E6_3.16 = 3.22 (2) and E5-E6_3.16 = 3.22 (3) are consecutive and result in the same amino acid change. To visualize its effects on the amino acid sequence, attention was paid to the possible combinations of nucleotides found through the E. coli strain collection . The combinations of the two changing positions led to the possibility of 13 SNP variants that can be translated into 6 different amino acids. As expected, the guanine adenine combination was associated with the highest invasion values (0.63% ± 0.76). Statistically significant differences were observed according to the patotype when the guanine-adenine combination (n = 7) was compared with the cytosine-guanine combination (n = 11) (p = 0.009). The first leads to a basic amino acid at pH = 7 (serine), while the latter encodes a neutral amino acid (alanine) that can affect the function of the protein.
    [0818]
    [0819] Example 6.- Usefulness of SNPs as molecular signatures for the identification of AIEC
    [0820] The use of a binary logistic regression model revealed two SNPs that were predictive of the AIEC phenotype (Table 9).
    [0821] Table 9. Binary logistic regression model for SNPs associated with the AIEC patotype. The variables of the equation are indicated, the risk of being AIEC (odds ratio), the p-value of the regression model and the percentage of successfully classified strains.
    [0822]
    [0823] Variables of the predicted equation
    [0824]
    [0825] B Value Reason IC of Observed Different AIEC%%
    [0826] of p of 95% of correct global probabi AIEC
    [0827] qualities
    [0828]
    [0829] It has no G in 2,004 73.0
    [0830] 2,420 0.006 11,250 non-AIEC 12 8 60.0
    [0831] E3-E4_4.4 63,168
    [0832]
    [0833] Constant 0.019 0.167 AIEC 2 15 88.2
    [0834] 1,792
    [0835]
    [0836] It has G in E5- 1,430 68.9
    [0837] 2,559 0,023 12,923 non-AIEC 24 1 96.0
    [0838] E6_3.16 = 3.22 (2) 116,785
    [0839]
    [0840] Constant 0.075 0.542 AIEC 13 7 35.0
    [0841] 0.613
    [0842]
    [0843] The SNP in E3-E4_4.4 can classify the strains as AIEC or non-AIEC with a global success of 73%; E. coli strains with a nucleotide base other than guanine in this position have a 65.2% probability of presenting the AIEC phenotype, while the strains that present it have only a 14.3% probability of presenting the AIEC phenotype. In the case of SNP E5-E6_3.16 = 3.22 (2), the overall success was similar (68.9%), but only 35% of the AIEC strains were correctly classified.
    [0844]
    [0845] Although the overall success in predicting AIEC based on the SNP in E3-E4_4.4 was high, 40% of non-AIEC strains were misclassified as AIEC. To improve the specificity of prediction, a classification algorithm was designed based on the identification of nucleotides present in three SNPs (Figure 5). In this algorithm, the variant in SNP E3-E4_4.4 is determined first, and the strains containing a guanine are classified as non-AIEC with a probability of success of 85.7%. Then, in those strains with another result in SNP E3-E4_4.4 they are analyzed for the gene E5-E6_3.16 = 3.22 (2). The resulting isolates are classified as AIEC or non-AIEC depending on the combined results obtained for both genes. With this method, the probability of success ranges between 71.4% and 100%, with the exception of isolates that have different guanine nucleotides in both genes, which still cannot be classified. For this reason, a third gene (E5-E6_3.12) was included. In spite of not
    [0846]
    [0847]
    [0848] found more frequently in AIEC (specifically 39.3% of non-AlEC and 22.7% of AIEC had adenine, while 60.7% of non-AIEC and 77.3% of AIEC had guanine; p = 0.197), this gene was useful in the classification of this group of strains. Overall, the classification algorithm has 82.1% specificity, 86.4% sensitivity and 84% accuracy within the strain collection.
    [0849]
    [0850] These results collectively suggest that although specific molecular signatures for AIEC and present in all AIECs could not be found, with the present approach some genes with polymorphisms have been identified that may represent an advantage or disadvantage for the adhesion and invasion capabilities of E. coli and therefore may be involved in the AIEC phenotype. In addition, a novel molecular strategy based on the identification of nucleotides present in three polymorphic sites that can be implemented as a tool for the identification of AIEC has been designed.
    [0851]
    [0852] BIBLIOGRAPHY
    [0853]
    [0854] 1. Sartor, RB Mechanisms of disease: pathogenesis of Crohn's disease and ulcerative colitis. Nat Clin Pr. Gastroenterol Hepatol 3, 390-407 (2006).
    [0855] 2. Martínez-Medina, M. et al. Molecular diversity of Escherichia coli in the human gut:
    [0856] New ecological evidence supporting the role of adherent-invasive E. coli (AIEC) in Crohn's disease. Inflamm Bowel Dis. 15, 872-882 (2009).
    [0857] 3. Darfeuille-Michaud, A. et al. High prevalence of adherent-invasive Escherichia coli associated with ileal mucosa in Crohn's disease. Gastroenterology 127, 412-421 (2004).
    [0858] 4. Baumgart, M. et al. Culture independent analysis of ileal mucosa reveals a selective increase in invasive Escherichia coli of novel phylogeny relative to depletion of Clostridiales in Crohn's disease involving the ileum. ISME J. 1, 403-418 (2007).
    [0859] 5. López-Siles, M. et al. Mucosa-associated Faecalibacterium prausnitzii and Escherichia coli co-abundance can distinguish Irritable Bowel Syndrome and Inflammatory Bowel Disease phenotypes. Int. J. Med. Microbiol. 304, 464-475 (2014).
    [0860] 6. Boudeau, J., Glasser, AL, Masseret, E., Joly, B. & Darfeuille-Michaud, A. Invasive ability of an Escherichia coli strain isolated from the ileal mucosa of a patient with Crohn's disease. Infect Immun 67, 4499-509 (1999).
    [0861] 7. Martin, HM et al. Enhanced Escherichia coli adherence and invasion in Crohn's disease and colon cancer. Gastroenterology 127, 80-93 (2004).
    [0862] Sasaki, M. et al. Invasive Escherichia coli are a feature of Crohn’s disease. Lab. Investig. 87, (2007).
    [0863] Eaves-Pyles, T. et al. Escherichia coli isolated from a Crohn’s disease patient adheres, invades, and induces inflammatory responses in polarized intestinal epithelial cells. Int. J. Med. Microbiol. 298, 397-409 (2008).
    [0864] Dogan, B. et al. Multidrug resistance is common in Escherichia coli associated with Ileal Crohn’s Disease. Inflamm Bowel Dis. 19, 141-150 (2013).
    [0865] Miquel, S. et al. Complete genome sequence of crohn’s disease-associated adherentinvasive E. coli strain LF82. PLoS One 5, 1-16 (2010).
    [0866] Nash, J. H. et al. Genome sequence of adherent-invasive Escherichia coli and comparative genomic analysis with other E. coli pathotypes BMC Genomics 11, 667 (2010).
    [0867] Martínez-Medina, M. et al. Similarity and divergence among adherent-invasive Escherichia coli and extraintestinal pathogenic E. coli strains J. Clin. Microbiol 47, 3968-79 (2009).
    [0868] Kotlowski, R., Bernstein, C. N., Sepehri, S. & Krause, D. O. High prevalence of Escherichia coli belonging to the B2 + D phylogenetic group in inflammatory bowel disease. Gut 56, 669-75 (2007).
    [0869] Conte, M. P. et al. Adherent-invasive Escherichia coli (AIEC) in pediatric Crohn’s disease patients: phenotypic and genetic pathogenic features. BMC Res. Notes 7, 748 (2014).
    [0870] Cieza, R. J., Hu, J., Ross, B. N., Sbrana, E. & Torres, A. G. The IbeA invasin of adherent-invasive Escherichia coli mediates interaction with intestinal epithelia and macrophages. Infect Immun 83, 1904-18 (2015).
    [0871] Dogan, B. et al. Inflammation-associated Adherent-invasive Escherichia coli are enriched in pathways for use of propanediol and iron and M-cell. Inflamm Bowel Dis.
    [0872] 20, 1919-1932 (2014).
    [0873] Gibold, L. et al. The Vat-AIEC protease promotes crossing of the intestinal mucus layer by Crohn’s disease-associated Escherichia coli. Cell Microbiol n / a-n / a (2015). doi: 10.1111 / cmi.12539
    [0874] Martínez-medina, M. & Garcia-gil, L. J. Escherichia coli in chronic inflammatory bowel diseases: An update on adherent invasive Escherichia coli pathogenicity 5, 213-227 (2014).
    [0875] Vazeille, E. et al. GipA factor supports colonization of Peyer’s Patches by Crohn’s Disease-associated Escherichia coli. Inflamm Bowel Dis. 22, 68-81 (2016).
    [0876]
    [0877]
    [0878] Chassaing, B. et al. Crohn disease-associated adherent-invasive E. coli bacteria target mouse and human Peyer’s patches via long polar fimbriae. J. Clin. Invest. 121, 966-75 (2011).
    [0879] lebba, V. et al. Microevolution in fimH gene of mucosa-associated Escherichia coli strains isolated from pediatric patients with inflammatory bowel disease. Infect Immun 80, 1408-17 (2012).
    [0880] Dreux, N. et al. Point mutations in FimH Adhesin of Crohn’s Disease-associated Adherent-invasive Eschenchia coli enhance intestinal inflammatory response. PLoS Pathog. 9, 1-17 (2013).
    [0881] Desilets, M. et al. Genome-based definition of an Inflammatory Bowel Diseaseassociated Adherent-invasive Eschenchia coli pathovar Inflamm Bowel Dis. 0, 1-12 (2015).
    [0882] Rolhion, N. et al. Abnormally expressed ER stress response chaperone Gp96 in CD favors adherent-invasive Eschenchia coli invasion. Gut 59, 1355-62 (2010).
    [0883] Low, D. et al. Chitin-binding domains of Eschenchia coli ChiA mediate interactions with intestinal epithelial cells in mice with colitis. Gastroenterology 145, 602-12.e9 (2013).
    [0884] O'Brien, C. L. et al. Comparative genomics of Crohn’s disease-associated adherentinvasive Escherichia coli. Gut gutjnl-2015-311059 (2016). doi: 10.1136 / gutjnl-2015-311059
    [0885] Deshpande, N. P., Wilkins, M. R., Mitchell, H. M. & Kaakoush, N. O. Novel genetic markers defines a subgroup of pathogenic Escherichia coli strains belonging to the B2 phylogenetic group. FEMS Microbiol. Lett. 1-7 (2015). doi: 10.1093 / femsle / fnv193 Rolhion, N., Carvalho, F. A. & Darfeuille-Michaud, A. OmpC and the aE regulatory pathway are involved in adhesion and invasion of the Crohn’s disease-associated Escherichia coli strain LF82. Mol. Microbiol 63, 1684-1700 (2007).
    [0886] Vannini, A. et al. The crystal structure of the quorum sensing protein TraR bound to its autoinducer and target DNA. EMBO J. 21, 4393-401 (2002).
    [0887] Allsopp, L. P. et al. UpaH is a newly identified autotransporter protein that contributes to biofilm formation and bladder colonization by uropathogenic Escherichia coli CFT073. Infect Immun.78, 1659-69 (2010).
    [0888] Martínez-Medina, M. et al. Biofilm formation as a novel phenotypic feature of adherent-invasive Escherichia coli (AIEC). BMC Microbiol. 9, 202 (2009).
    [0889] Altschul, S. F. et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389-402 (1997).
    [0890]
    [0891]
    [0892] Milne, I. et al. Using Tablet for visual exploration of second-generation sequencing data. Brief Bioinform 14, 193-202 (2013).
    [0893] Prorok-Hamon, M. et al. Colonic mucosa-associated diffusely adherent afaC + Escherichia coli expressing lpfA and pks are increased in inflammatory bowel disease and colon cancer. Gut 63, 761-70 (2014).
    [0894] Céspedes, S. et al. Genetic diversity and virulence determinants of Escherichia coli strains isolated from patients with Crohn's Disease in Spain and Chile. Front. Microbiol 8, 639 (2017).
    [0895] Olson, ND et al. Best practices for evaluating single nucleotide variant calling methods for microbial genomics. Front. Genet 6, 235 (2015).
    [0896] McElroy, K., Thomas, T. & Luciani, F. Deep sequencing of evolving pathogen populations: applications, errors, and bioinformatic solutions. Microb. Inform. Exp. 4, 1 (2014).
    [0897] den Bakker, HC et al. Comparative genomics of the bacterial genus Listeria: Genome evolution is characterized by limited gene acquisition and limited gene loss. BMC Genomics 11, 688 (2010).
    [0898] Herring, CD et al. Comparative genome sequencing of Escherichia coli allows observation of bacterial evolution on a laboratory timescale. Nat. Genet. 38, 1406 1412 (2006).
    [0899] Meng, X. et al. Virulence characteristics of extraintestinal pathogenic Escherichia coli deletion of gene encoding the outer membrane protein X. J. Vet. Med. Sci 78, 1261 1267 (2016).
    [0900] Pulkkinen, WS & Miller, IF Salmonella typhimurium virulence protein is similar to Yersinia enterocolitica to invasion bacteriophage lambda protein and outer membrane protein. J. Bacteriol. 173, 86-93 (1991).
    [0901] Spurbeck, RR et al. Escherichia coli isolates that carry vat, fyuA, chuA, and yfcV efficiently colonize the urinary tract. Infect Immun 80, 4115-22 (2012).
    [0902] Thompson, JD, Higgins, DG & Gibson, TJ CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673-80 (1994).
    [0903] Bankevich, A. et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 19, 455-77 (2012).
    [0904] Pareja-Tobes, P., Manrique, M., Pareja-Tobes, E., Pareja, E. & Tobes, R. BG7: a new approach for bacterial genome annotation designed for next generation sequencing data. PLoS One 7 e49239 (2012).
    [0905] Darling, AE, Mau, B. & Perna, NT progressiveMauve: multiple genome alignment with gene gain, loss and rearrangement. PLoS One 5, e11147 (2010).
    [0906] Grissa, I., Vergnaud, G. & Pourcel, C. CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats. Nucleic Acids Res. 35, W52-W57 (2007).
    [0907] Wang, Y., Coleman-Derr, D., Chen, G. & Gu, YQ OrthoVenn: A web server for genome wide comparison and annotation of orthologous clusters across multiple species. Nucleic Acids Res. 43, W78-W84 (2015).
    [0908] Treangen, TJ, Ondov, BD, Koren, S. & Phillippy, AM The Harvest suite for rapid core-genome alignment and visualization of thousands of intraspecific microbial genomes. Genome Biol. 15, 524 (2014).
    [0909] Krause, DO, Little, AC, Dowd, SE & Bernstein, CN Complete genome sequence of adherent invasive Escherichia coli UM146 isolated from ileal crohn's disease biopsy tissue. J. Bacteríol. 193, 583 (2011).
    [0910] Gene Ontology Consortium, T. G. O. Gene Ontology Consortium: going forward.
    [0911] Nucleic Acids Res. 43, D1049-56 (2015).
    [0912] Finn, RD et al. The Pfam protein families database: towards a more sustainable future. Nucleic Acids Res. 44, D279-85 (2016).
    [0913] Sivignon A, et al. Development of heptylmannosidebased glycoconjugate antiadhesive compounds against adherent-invasive Escherichia coli bacteria associated with Crohn's disease. mBio 6 (6): e01298-15 (2015).
    [0914] Sivignon A, et al. The potential of FimH as a novel therapeutic target for the treatment of Crohn's disease. Expert Opinion on Therapeutic Targets , 21 : 9, 837-847, (2017). Subramanian S, et al. Replication of colonic Crohn's disease mucosal Escherichia coli isolates within macrophages and their susceptibility to antibiotics. Antimicrob Agents Chemother .; 52 (2): 427-434 (2008).
    [0915] Galtier M, et al. Bacteriophages targeting adherent invasive Escherichia coli strains as a promising new treatment for Crohn's disease. J Crohns Colitis.jjw 224 (2017).
    [0916] Barnich N, et al ., CEACAM6 acts as a receptor for adherent-invasive E. coli , supporting ileal mucosa colonization in Crohn disease. J Clin Invest. ; 117 (6): 1566-1574 (2007).
    [0917] Sivignon A, et al . Saccharomyces cerevisiae CNCM I-3856 prevents colitis induced by AIEC bacteria in the transgenic mouse model mimicking Crohn's disease. Inflamm Bowel Dis. ; 21 (2): 276-286 (2015).
    [0918]
    [0919]
    [0920] Krause, DO, et al., Complete genome sequence of adherent invasive Escherichia coli UM146 isolated from Ileal Crohn's disease biopsy tissue, J. Bacteríol. 193 (2), 583 (2011)
    [0921] Gouin SG, Roos G, Bouckaert J. Carbohydrates as drugs: Discovery and application of FimH antagonists. Seeberger PH, Rademacher C, editors. Springer International Publishing (Basel, Switzerland). P. 123-168 (2014).
    [0922] Mydock-McGrane LK, Cusumano ZT, Janetka JW. Mannose-derived FimH antagonists: a promising anti-virulence therapeutic strategy for urinary tract infections and Crohn's disease. Expert Opin Ther Pat .; 26 (2): 175-197 (2016).
    [0923] Grabosch C, Hartmann M, Schmidt-Lassen J, et al. Squaric acid monoamide mannosides as ligands for the bacterial lectin FimH: covalent inhibition or not ChemBioChem .; 12 (7): 1066-1074 (2011).
    [0924] Firon N, Ashkenazi S, Mirelman D, et al. Aromatic alpha-glycosides of mannose are powerful inhibitors of the adherence of type 1 fimbriated Escherichia coli to yeast and intestinal epithelial cells. Infect Immun .; 55 (2): 472-476 (1987).
    [0925] Bernardi A, Jiménez-Barbero J, Casnati A, et al. Multivalent glycoconjugates as antipathogenic agents. Chem Soc Rev .; 42 (11): 4709-4727 (2013).
    [0926] pson KW, Dogan B, Rishniw M, et al. Adherent and invasive Escherichia coli is associated with granulomatous colitis in boxer dogs, Infect Immun .; 74 (8): 4778-92 (2006).
    [0927]
    [0928]
    7
    权利要求:
    Claims (18)
    [1]
    1. Method for determining or predicting whether an E. coli strain has an adherent-invasive E. coli (AIEC) phenotype, wherein said method comprises:
    a) determine the presence or absence of the E3-E4_4.4 gene in the genome of the E. coli strain , and when present, determine the genotype at the E3-E4_4.4 polymorphic site corresponding to position 1433063 bp of the genome of the reference AIEC strain UM146 (SNP E3-E4_4.4);
    wherein the presence of a G nucleotide at the polymorphic site of a) is indicative of a phenotype other than AIEC.
    [2]
    2. The method according to claim 1, wherein said method further comprises:
    b) determine the presence or absence of the E5-E6_3.16 = 3.22 gene in the genome of the E. coli strain , and when present determine the genotype at the E5-E6_3.16 polymorphic site = 3.22 (2) corresponding to position 2212845 bp of the genome of the AIEC reference strain UM146 (SNP E5-E6_3.16 = 3.22 (2));
    wherein the absence of the E3-E4_4.4 gene in a), and the presence of a G nucleotide at the polymorphic site of b) are indicative of an AIEC phenotype.
    [3]
    3. Method according to claim 1, wherein said method further comprises:
    b) determine the presence or absence of the E5-E6_3.16 = 3.22 gene in the genome of the E. coli strain , and when present determine the genotype in SNP E5-E6_3.16 = 3.22 (2);
    c) determine the presence or absence of the E5-E6_3.12 gene in the genome of the E. coli strain, and when present determine the genotype at the E5-E6_3.12 polymorphic site corresponding to position 4271710 bp of the genome of reference AIEC strain UM146 (SNP E5-E6_3.12);
    wherein the presence of a nucleotide other than G at the polymorphic site of a), the presence of a nucleotide other than G at the polymorphic site of b) and the presence of an A at the polymorphic site of c) are indicative of a different phenotype of AIEC.
    [4]
    4. Method according to any one of claims 1 to 3, wherein said method further comprises determining the genotype of one, two, three or more of the SNPs selected from the group consisting of: E1-E2_3.6, E3-E4_4. 3 (1), E3-E4_4.3 (2), E3-
    E4_4.3 (3), E5-E6_3.16 = 3.22 (1), E5-E6_3.16 = 3.22 (3), E5-E6_3.16 = 3.22 (4), E5-
    E6_3.16 = 3.22 (5), and E5-E6_3.16 = 3.22 (6).
    [5]
    5. A method according to any one of claims 1 to 4, wherein said E. coli strain is from any phylogenetic group, preferably from the phylogenetic groups A, D, B2 or B1.
    [6]
    Method according to any one of claims 1 to 5, in which genotyping is performed by a method selected from the group consisting of direct sequencing, restriction fragment length polymorphism (RFLP) analysis, hybridization with allele-specific oligonucleotides ( ASO), allele specific polymerase chain reaction (PCR); PCR and sequencing, PCR using mutagenic primers; ligase-PCR, excision by HOT; gel electrophoresis with gradient denaturation (DGGE), gel electrophoresis with temperature denaturation gradient (TGGE), single chain conformational polymorphism (SSCP), high performance liquid chromatography with denaturation, DNA microalignment, metagenomics and recognition of aptamers.
    [7]
    7. Method according to any of claims 1 to 6, wherein genotyping is performed by a method comprising PCR and sequencing.
    [8]
    A method according to any one of claims 1 to 7, wherein said method comprises a step of DNA extraction before the determination of the genotype of the target SNP.
    [9]
    A method according to any one of claims 1 to 8, wherein said E. coli strain has been obtained from an intestinal sample of a subject, preferably from a stool sample.
    one
    [10]
    10. Method according to any of claims 1 to 9, wherein said subject is a human subject.
    [11]
    A method according to any one of claims 1 to 10, wherein said method further comprises storing the results of the method in a data carrier, preferably wherein said data carrier is a computer-readable medium.
    [12]
    12. Computer implemented method, wherein the method is as defined in any of claims 1 to 11.
    [13]
    13. Method for classifying a subject as an AIEC carrier according to the presence of E. coli of the AIEC phenotype in its intestinal tract, in which said method comprises:
    to. isolate strains of E. coli from an intestinal sample obtained from a subject;
    b. optionally, extract DNA from said E. coli strains ;
    C. determine or predict the presence of E. coli of the AIEC phenotype using a method according to any one of claims 1 to 12.
    [14]
    14. Method for examining AIEC carrier subjects or monitoring AIEC carrier status in a subject, wherein said method comprises steps a) to c) according to claim 13.
    [15]
    15. Method for classifying a subject as an AIEC carrier according to claim 13, or method for examining or monitoring a subject according to claim 14, wherein said subject has Crohn's disease (CD).
    [16]
    16. Kit suitable for determining in the genome of a strain of E. coli at least the genotype of SNP E3-E4_4.4, and optionally to determine the genotype of SNP E5-E6_3.16 = 3.22 (2) and SNP E5- E6_3.12, in which said kit comprises:
    - an oligonucleotide specific for a target sequence comprising SNP E3-E4_4.4;
    - optionally, further comprising an oligonucleotide specific for a target sequence comprising SNP E5-E6_3.16 = 3.22 (2);
    - optionally, further comprising an oligonucleotide specific for a target sequence comprising SNP E5-E6_3.12; Y
    2
    - optionally, further comprising instructions for the use of said reagent (s) in a method for determining the genotype of the target SNP.
    [17]
    17. Kit according to claim 16, wherein:
    - said oligonucleotide specific for a target sequence comprising SNP E3-E4_4.4 is a nucleic acid sequence comprising SEQ ID NO: 13, SEQ ID NO: 14 or a sequence with an identity of at least about 90%, preferably at least about 95%, 96%, 97%, 98% or 99% with it; I
    - said oligonucleotide specific for a target sequence comprising SNP E5-E6_3.16 = 3.22 (2) is a nucleic acid sequence comprising SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 30, SEQ ID NO: 31, or a sequence with an identity of at least about 90%, preferably at least about 95%, 96%, 97%, 98% or 99% with it; I
    - said oligonucleotide specific for a target sequence comprising SNP E5-E6_3.12 is a nucleic acid sequence comprising SEQ ID NO: 21, SEQ ID NO: 22 or a sequence with an identity of at least about 90%, preferably at least about 95%, 96%, 97%, 98% or 99% with it.
    [18]
    18. Use of a kit according to any of claims 16 or 17, to determine or predict whether an E. coli strain has an AIEC phenotype.
    类似技术:
    公开号 | 公开日 | 专利标题
    Keller et al.2012|New insights into the Tyrolean Iceman's origin and phenotype as inferred by whole-genome sequencing
    Normann et al.2013|Intestinal microbial profiles in extremely preterm infants with and without necrotizing enterocolitis
    Lau et al.2015|Evidence for Elizabethkingia anophelis transmission from mother to infant, Hong Kong
    US20130045874A1|2013-02-21|Method of Diagnostic of Inflammatory Bowel Diseases
    US20150211053A1|2015-07-30|Biomarkers for diabetes and usages thereof
    Dilhari et al.2017|Evaluation of the impact of six different DNA extraction methods for the representation of the microbial community associated with human chronic wound infections using a gel-based DNA profiling method
    US20130005586A1|2013-01-03|Method of diagnostic of obesity
    Kennedy et al.2018|The impact of NOD2 variants on fecal microbiota in Crohn’s disease and controls without gastrointestinal disease
    Nie et al.2012|Deep sequencing-based transcriptome analysis of chicken spleen in response to avian pathogenic Escherichia coli | infection
    WO2011140208A2|2011-11-10|Methods and compositions for diagnosing and treating autoimmune disorders
    Ragimbeau et al.2014|Investigating the host specificity of Campylobacter jejuni and Campylobacter coli by sequencing gyrase subunit A
    Jiang et al.2020|Clinical relevance and plasmid dynamics of mcr-1-positive Escherichia coli in China: a multicentre case-control and molecular epidemiological study
    Liu et al.2018|Whole-exome sequencing identified a novel compound heterozygous mutation of LRRC6 in a Chinese primary ciliary dyskinesia patient
    US20140193824A1|2014-07-10|High-Resolution Clonal Typing of Escherichia coli
    CN103757028A|2014-04-30|OSBPL2 mutant gene as well as identification method and detection kit thereof
    Miller et al.2015|Whole-genome sequencing of three clonal clinical isolates of B. cenocepacia from a patient with cystic fibrosis
    ES2724874B2|2020-11-24|New molecular markers for the invasive adherent Escherichia coli | pathotype, related methods and kits
    Xie et al.2014|An analysis of the Malassezia species distribution in the skin of patients with pityriasis versicolor in Chengdu, China
    Jiang et al.2020|Changes in the intestinal microbiota in patients with stage 5 chronic kidney disease on a low-protein diet and the effects of human to rat fecal microbiota transplantation
    Baron et al.2021|Whole genome sequencing to decipher the virulence phenotype of hypervirulent Klebsiella pneumoniae responsible for liver abscess, Marseille, France
    Wu et al.2018|Whole-genome characterization of Shewanella algae strain SYT3 isolated from seawater reveals insight into hemolysis
    Klaassens et al.2011|The fecal bifidobacterial transcriptome of adults: a microarray approach
    CN108064263A|2018-05-22|Biomarker for rheumatoid arthritis and application thereof
    US20190085377A1|2019-03-21|Genetic testing for predicting resistance of salmonella species against antimicrobial agents
    EP3325659A2|2018-05-30|Genetic testing for predicting resistance of gram-negative proteus against antimicrobial agents
    同族专利:
    公开号 | 公开日
    ES2724874B2|2020-11-24|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    法律状态:
    2019-09-17| BA2A| Patent application published|Ref document number: 2724874 Country of ref document: ES Kind code of ref document: A1 Effective date: 20190917 |
    2020-11-24| FG2A| Definitive protection|Ref document number: 2724874 Country of ref document: ES Kind code of ref document: B2 Effective date: 20201124 |
    优先权:
    申请号 | 申请日 | 专利标题
    ES201830112A|ES2724874B2|2018-02-08|2018-02-08|New molecular markers for the invasive adherent Escherichia colipathotype, related methods and kits|ES201830112A| ES2724874B2|2018-02-08|2018-02-08|New molecular markers for the invasive adherent Escherichia colipathotype, related methods and kits|
    [返回顶部]